ID: 1124750539

View in Genome Browser
Species Human (GRCh38)
Location 15:32368711-32368733
Sequence AAGGCTGAGGATCCAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750533_1124750539 1 Left 1124750533 15:32368687-32368709 CCCCTCATTTGTTTTCTCCTTCT No data
Right 1124750539 15:32368711-32368733 AAGGCTGAGGATCCAGCTCCAGG No data
1124750532_1124750539 2 Left 1124750532 15:32368686-32368708 CCCCCTCATTTGTTTTCTCCTTC No data
Right 1124750539 15:32368711-32368733 AAGGCTGAGGATCCAGCTCCAGG No data
1124750534_1124750539 0 Left 1124750534 15:32368688-32368710 CCCTCATTTGTTTTCTCCTTCTC No data
Right 1124750539 15:32368711-32368733 AAGGCTGAGGATCCAGCTCCAGG No data
1124750535_1124750539 -1 Left 1124750535 15:32368689-32368711 CCTCATTTGTTTTCTCCTTCTCA No data
Right 1124750539 15:32368711-32368733 AAGGCTGAGGATCCAGCTCCAGG No data
1124750531_1124750539 3 Left 1124750531 15:32368685-32368707 CCCCCCTCATTTGTTTTCTCCTT No data
Right 1124750539 15:32368711-32368733 AAGGCTGAGGATCCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750539 Original CRISPR AAGGCTGAGGATCCAGCTCC AGG Intergenic
No off target data available for this crispr