ID: 1124750755

View in Genome Browser
Species Human (GRCh38)
Location 15:32369999-32370021
Sequence GGTCGTAAGTGACCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750755_1124750758 17 Left 1124750755 15:32369999-32370021 CCTTGGGCAGGTCACTTACGACC No data
Right 1124750758 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750755 Original CRISPR GGTCGTAAGTGACCTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr