ID: 1124750757

View in Genome Browser
Species Human (GRCh38)
Location 15:32370039-32370061
Sequence CCAGCATCATTTCAAAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750757_1124750760 1 Left 1124750757 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data
Right 1124750760 15:32370063-32370085 AATTGTGCCCTCCTCCCAGGTGG No data
1124750757_1124750761 2 Left 1124750757 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data
Right 1124750761 15:32370064-32370086 ATTGTGCCCTCCTCCCAGGTGGG No data
1124750757_1124750759 -2 Left 1124750757 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data
Right 1124750759 15:32370060-32370082 GGTAATTGTGCCCTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750757 Original CRISPR CCAGCATCATTTCAAAGACA AGG (reversed) Intergenic
No off target data available for this crispr