ID: 1124750758

View in Genome Browser
Species Human (GRCh38)
Location 15:32370039-32370061
Sequence CCTTGTCTTTGAAATGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750755_1124750758 17 Left 1124750755 15:32369999-32370021 CCTTGGGCAGGTCACTTACGACC No data
Right 1124750758 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data
1124750756_1124750758 -4 Left 1124750756 15:32370020-32370042 CCTGTCTGAGCAGAATTTGCCTT No data
Right 1124750758 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750758 Original CRISPR CCTTGTCTTTGAAATGATGC TGG Intergenic
No off target data available for this crispr