ID: 1124750761

View in Genome Browser
Species Human (GRCh38)
Location 15:32370064-32370086
Sequence ATTGTGCCCTCCTCCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124750756_1124750761 21 Left 1124750756 15:32370020-32370042 CCTGTCTGAGCAGAATTTGCCTT No data
Right 1124750761 15:32370064-32370086 ATTGTGCCCTCCTCCCAGGTGGG No data
1124750757_1124750761 2 Left 1124750757 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG No data
Right 1124750761 15:32370064-32370086 ATTGTGCCCTCCTCCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124750761 Original CRISPR ATTGTGCCCTCCTCCCAGGT GGG Intergenic
No off target data available for this crispr