ID: 1124751584

View in Genome Browser
Species Human (GRCh38)
Location 15:32374667-32374689
Sequence CAGTGGGCCCAGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124751584_1124751592 14 Left 1124751584 15:32374667-32374689 CCATCCACTCTCTGGGCCCACTG No data
Right 1124751592 15:32374704-32374726 TGACCGAGAGCCTCCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124751584 Original CRISPR CAGTGGGCCCAGAGAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr