ID: 1124755306

View in Genome Browser
Species Human (GRCh38)
Location 15:32400425-32400447
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124755295_1124755306 21 Left 1124755295 15:32400381-32400403 CCTCCGCCCAGAGCCTCTTACCT 0: 6
1: 13
2: 17
3: 27
4: 270
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755299_1124755306 8 Left 1124755299 15:32400394-32400416 CCTCTTACCTCCAGATCTTTCAG 0: 10
1: 12
2: 24
3: 28
4: 252
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755298_1124755306 14 Left 1124755298 15:32400388-32400410 CCAGAGCCTCTTACCTCCAGATC 0: 18
1: 20
2: 6
3: 24
4: 207
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755297_1124755306 15 Left 1124755297 15:32400387-32400409 CCCAGAGCCTCTTACCTCCAGAT 0: 18
1: 21
2: 6
3: 21
4: 174
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755302_1124755306 1 Left 1124755302 15:32400401-32400423 CCTCCAGATCTTTCAGGGTAGCA 0: 10
1: 12
2: 12
3: 20
4: 126
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755303_1124755306 -2 Left 1124755303 15:32400404-32400426 CCAGATCTTTCAGGGTAGCAGAT 0: 10
1: 13
2: 17
3: 12
4: 129
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755296_1124755306 18 Left 1124755296 15:32400384-32400406 CCGCCCAGAGCCTCTTACCTCCA 0: 8
1: 3
2: 0
3: 34
4: 345
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902276979 1:15346874-15346896 ATAATGGAGGGCCTGGCCTGCGG + Intronic
903971976 1:27124861-27124883 AAGATGGGGGGCCTTCCCAGAGG + Intronic
905369636 1:37476169-37476191 ATGCTGTGGGTCCCTCCCTGAGG + Intronic
905798604 1:40829479-40829501 AGGATGTAGGGCCATCCTTAGGG - Intronic
905936542 1:41828483-41828505 AAGATGAATGGCCTTCCCTGGGG + Intronic
906711329 1:47932199-47932221 ATGATGTAAGACCATCCATGAGG + Intronic
907627256 1:56042394-56042416 ATGATGTAATTACTTCCCTGGGG - Intergenic
908383680 1:63620227-63620249 AGAATGTAGTGCCTTGCCTGGGG + Intronic
909545694 1:76844022-76844044 GTGGGGTAGGGACTTCCCTGAGG + Intergenic
910476192 1:87609896-87609918 ATGAGGCAGGGCATTCCCTGTGG + Intergenic
912724118 1:112043748-112043770 CTGTTGTAGGTCCTACCCTGCGG - Intergenic
919596377 1:199568568-199568590 ATGCTGAAGGGCCTTACCTGAGG - Intergenic
920545516 1:206813343-206813365 ATGATGAAGGAGCTTCTCTGGGG - Intronic
1065925871 10:30433741-30433763 AAGATATACGACCTTCCCTGGGG + Intergenic
1067415823 10:46101630-46101652 AGGATGTATGGCGTTCCCTTGGG + Intergenic
1069398028 10:68010765-68010787 CTGATGTGGGGCTTACCCTGGGG - Intronic
1072309757 10:94143075-94143097 ATGGTATAGGGACTTCCCTCTGG - Intronic
1074816976 10:117149725-117149747 ATGGGGTAGGGTCTTGCCTGGGG - Intergenic
1074885249 10:117688364-117688386 AAGATGAAGTGCCTTTCCTGGGG - Intergenic
1078098480 11:8314739-8314761 CGCATGTGGGGCCTTCCCTGGGG + Intergenic
1078753491 11:14187207-14187229 ATGGCTTAGTGCCTTCCCTGAGG - Intronic
1083591522 11:63898074-63898096 CTCATGCACGGCCTTCCCTGTGG - Intronic
1084395172 11:68904529-68904551 AGGAGGAAGGCCCTTCCCTGGGG + Intronic
1087008858 11:93494900-93494922 ATCATGCAGGTCCTTCCTTGGGG - Intronic
1091993001 12:4972086-4972108 ATGACTTGGTGCCTTCCCTGCGG - Intergenic
1096029331 12:48397969-48397991 AGGATGTAAAGGCTTCCCTGAGG - Intergenic
1096448285 12:51715072-51715094 CTGATTTAGGGCATTCCCTAAGG - Intronic
1096584942 12:52613924-52613946 ATGGTCTAGGGCCATCCCTCTGG - Intronic
1101605695 12:106246920-106246942 CTGAGGTGGGGCCTTGCCTGAGG + Intronic
1102429232 12:112868654-112868676 ATGATGTCAGGCCATCCCTCAGG - Intronic
1102883264 12:116502490-116502512 ATGATGTAAGGTCTTCTGTGTGG + Intergenic
1103721630 12:122978534-122978556 ATGGTGTTGGGCCTCCCCTTAGG - Exonic
1104794766 12:131509728-131509750 AACAGGTAGGGCCTTCTCTGAGG - Intergenic
1106591453 13:31102095-31102117 ATGATGTAGATACTTCCTTGAGG - Intergenic
1110371313 13:74743575-74743597 AGCATTTAGAGCCTTCCCTGGGG - Intergenic
1111861658 13:93714900-93714922 ATCATGTAGGGCTTTTCCAGTGG + Intronic
1113547797 13:111167831-111167853 AGAATGTAGTGCCTTTCCTGGGG + Intronic
1114627116 14:24136892-24136914 GTTATGTAGGGCCTGACCTGGGG - Intronic
1116446412 14:45017288-45017310 ATGATTTTTGGGCTTCCCTGAGG + Intronic
1122768510 14:104086672-104086694 GTGATGTGGGGCCTCCCTTGGGG + Intronic
1123472367 15:20564939-20564961 ATGATGTAGGGCTCTCCCCGTGG - Intergenic
1123645636 15:22435414-22435436 ATGATGTAGGGCTCTCCCCGTGG + Intergenic
1123732672 15:23159930-23159952 ATGATGTAGGGCTCTCCCCGTGG - Intergenic
1123750805 15:23357310-23357332 ATGATGTAGGGCTCTCCCCGTGG - Exonic
1123927921 15:25136351-25136373 ATGTTGAAGAGCGTTCCCTGTGG - Intergenic
1124283176 15:28381226-28381248 ATGATGTAGGGCTCTCCCCGTGG - Exonic
1124299523 15:28530387-28530409 ATGATGTAGGGCTCTCCCCGTGG + Exonic
1124481764 15:30085797-30085819 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124488220 15:30137895-30137917 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124536837 15:30554815-30554837 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124543311 15:30606869-30606891 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124563268 15:30794321-30794343 ATGATGTAGGGCCCTCCCCGTGG - Intergenic
1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124761815 15:32452776-32452798 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124776814 15:32596292-32596314 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124960018 15:34386912-34386934 ATGATGTAGGGCCCTCCCCGTGG + Intronic
1124976647 15:34533133-34533155 ATGATGTAGGGCCCTCCCCGTGG + Intronic
1125205711 15:37151674-37151696 ATGATGCAGGGTCCTCCCTCAGG - Intergenic
1126580649 15:50239526-50239548 TTGATGCTGGGCCTTTCCTGGGG - Intergenic
1127775728 15:62263074-62263096 ATGATGCAGGGCCCTCCCAGTGG + Intergenic
1132118893 15:99159537-99159559 ATGAGGAAGGGCCTTCCAGGAGG + Intronic
1132433608 15:101779387-101779409 ATGATGTAGGGCCCTCCCCATGG + Intergenic
1134439000 16:14286293-14286315 AGGGTGTTGGGGCTTCCCTGAGG - Intergenic
1139209806 16:65066055-65066077 CTAATGAAGGGCTTTCCCTGAGG - Intronic
1140883330 16:79219276-79219298 CTGATGCTGGGCATTCCCTGAGG + Intergenic
1143093535 17:4464134-4464156 CTGGTCTGGGGCCTTCCCTGGGG + Intronic
1145006576 17:19341953-19341975 ATGAGGGAGGGCCTGGCCTGAGG + Intronic
1146453774 17:32994355-32994377 CTGATTTTGGGCCCTCCCTGAGG - Intronic
1146722554 17:35133321-35133343 ATGAGGTAGGGCCAACCCTCAGG - Exonic
1147256404 17:39184823-39184845 ATGACGTGGTGCCTTCCATGAGG - Exonic
1148186255 17:45646440-45646462 ATGATGTAAGGCCTTGACTTGGG + Intergenic
1151022016 17:70627913-70627935 ATGATGTAATGCTTTCCCAGTGG - Intergenic
1151230463 17:72681257-72681279 GTGATGTTGGGCCTACTCTGAGG + Intronic
1153137120 18:1929716-1929738 TGGATGGAGGGGCTTCCCTGTGG - Intergenic
1153653445 18:7261599-7261621 ATGAGGCTGGGGCTTCCCTGTGG - Intergenic
1156379719 18:36547060-36547082 AGGATGCAGGACCTTCCCAGGGG - Intronic
1159055894 18:63463639-63463661 ATGCTGTAGTGCCTGACCTGTGG + Intergenic
1159800893 18:72898215-72898237 ATGGTGTGGGTCCTTCCCTCTGG - Intergenic
1161596501 19:5153652-5153674 CTGATGTTGGGGCCTCCCTGGGG + Intergenic
1165071732 19:33259733-33259755 GTGCTGTAGGGCCTGCTCTGGGG - Intergenic
1166359337 19:42246310-42246332 GTGATGTAAGTCATTCCCTGGGG - Intronic
932505735 2:72229558-72229580 ATGCTCTAGAGCCTTCACTGGGG - Intronic
935157965 2:100500683-100500705 ATTCTGGAGGTCCTTCCCTGAGG - Intergenic
935734667 2:106097199-106097221 GTGGTGTGGGGCCATCCCTGAGG + Intronic
935851088 2:107219712-107219734 ATGCTGTAGAGCCTGCCATGAGG - Intergenic
935943377 2:108264774-108264796 ATCATGTTGGGTCTTCCCTTGGG - Intronic
937908626 2:127064733-127064755 AGGATGCAGGGCCTGCCCTGGGG - Intronic
941288739 2:163648184-163648206 ATGGTTTGGGGCCTTCCTTGTGG - Intronic
948154234 2:235768584-235768606 AAGATGTAGGGCATTCTGTGGGG + Intronic
948586625 2:239023973-239023995 CTAATGTAGGGGCTTACCTGGGG - Intergenic
1169422945 20:5474303-5474325 ATCAGGGAGGGCCTTCCCAGAGG + Intergenic
1170297541 20:14844799-14844821 AAGAAGAAGAGCCTTCCCTGTGG + Intronic
1173141629 20:40490086-40490108 GGAATGTAGGGCATTCCCTGGGG - Intergenic
1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG + Intronic
1174086081 20:48008282-48008304 ATGGTTTAGCGCCATCCCTGAGG - Intergenic
1174352188 20:49976387-49976409 ATGCTATAGGGACATCCCTGAGG + Intergenic
1174480808 20:50830104-50830126 ACGATGTTGGTCCTCCCCTGGGG + Intronic
1174516985 20:51100254-51100276 AAAATGCAGGGCCTTTCCTGAGG - Intergenic
1179365171 21:40752334-40752356 ATGAGGTGGGGCCCTCCCTCTGG + Intronic
1179601581 21:42481131-42481153 ATGGTTTGGTGCCTTCCCTGTGG + Intronic
1180108390 21:45634596-45634618 CAGATGTGGGGTCTTCCCTGGGG - Intergenic
1181775805 22:25159363-25159385 GCGATGTAGGACCTTCCCCGGGG + Intronic
1182906485 22:33941929-33941951 ATGAGATACGTCCTTCCCTGTGG + Intergenic
1185315198 22:50175970-50175992 CTGATGTGGGCCCTGCCCTGGGG + Intronic
953872299 3:46637656-46637678 ATGCTGTATTTCCTTCCCTGTGG + Intergenic
956219751 3:66889669-66889691 ATGATCTGGGGTCTTCCCAGTGG + Intergenic
961607096 3:128104332-128104354 ATGATGGATGGGCTTCCCAGGGG - Intronic
962829311 3:139126134-139126156 AGGATGTAGTGACTTCCCTAGGG + Intronic
968489188 4:881058-881080 ACGAGGTGGGGCCCTCCCTGGGG + Intronic
969455094 4:7295938-7295960 CTGTTGCAGGGGCTTCCCTGAGG + Intronic
970813067 4:20118467-20118489 ATGATTTAGTGCCATCCCTTTGG - Intergenic
974779016 4:66527715-66527737 ATGGTGGTGGGTCTTCCCTGTGG + Intergenic
979447566 4:120832575-120832597 ATGATATAGTGCCTGCCCTCAGG - Intronic
979601654 4:122592251-122592273 ATGATGTAGTGCCATTCTTGTGG - Intergenic
986999098 5:13641021-13641043 ATGATTTAGCGCCATCCCTTCGG + Intergenic
991556321 5:67898566-67898588 ATGATGAGGGGCCTTCCCTATGG + Intergenic
991928730 5:71730750-71730772 TTTGTGTAGGGCTTTCCCTGAGG - Intergenic
994665785 5:102703773-102703795 ATCATGTAGGGCCTTCTAAGTGG + Intergenic
998163382 5:139826258-139826280 AAGATGTTTGGCCTTGCCTGGGG + Intronic
1000706136 5:164514536-164514558 ATGATGTATTTCCTTCCTTGAGG + Intergenic
1001630739 5:173173365-173173387 ATGACTTGGTGCCTTCCCTGTGG + Intergenic
1004413644 6:15404455-15404477 CTGAGGTAGGGCCCTCTCTGAGG - Intronic
1007219054 6:40264225-40264247 AAGATGGAGGACCTGCCCTGGGG + Intergenic
1012958738 6:105599462-105599484 ATGCTGCTGGGCGTTCCCTGAGG + Intergenic
1016246948 6:141994290-141994312 AGGATCTAGGGTCTTTCCTGTGG - Intergenic
1018730963 6:166650224-166650246 ATGAGATAAGGCCTCCCCTGGGG + Intronic
1022451880 7:30523430-30523452 ATGATGTAGGGCCCTCCCCGTGG + Intronic
1026573804 7:71555129-71555151 ATGGTTTGGTGCCTTCCCTGTGG - Intronic
1028418633 7:90607967-90607989 ATTATGTAGCCCCTTCACTGTGG - Intronic
1029063694 7:97826267-97826289 ATGATGTATTGGCTTCCATGTGG - Intergenic
1040366418 8:46721901-46721923 ATGATGTATTGGCTTCCATGTGG + Intergenic
1042383244 8:68143249-68143271 ATGATGTTGTGCCTTCCCCCTGG + Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1048862926 8:138737119-138737141 CGGAGGGAGGGCCTTCCCTGGGG - Intronic
1055169993 9:73245203-73245225 ATGAAGTACTGCCTCCCCTGTGG + Intergenic
1055508411 9:76971043-76971065 ATGAGGTAGGGACTGCACTGGGG - Intergenic
1055861628 9:80757093-80757115 ATGGTTTAGGGCCATCCCTTTGG - Intergenic
1056459098 9:86791896-86791918 ATGATGTAAAGACTTCCCAGTGG + Intergenic
1056896589 9:90556531-90556553 ATGATGTAGGTCCTTCTTTCTGG + Intergenic
1060828464 9:126699633-126699655 AAGATGCAGGGCCTGCCTTGAGG + Exonic
1060910434 9:127345597-127345619 TTTATCTAGGGCTTTCCCTGAGG - Intronic
1061038224 9:128125216-128125238 AGGATGCAGGGGGTTCCCTGGGG + Intronic
1187440472 X:19313444-19313466 GTTATGCAGGGCCTTCTCTGGGG - Intergenic
1191199647 X:57765879-57765901 ATAATGTAGGCACTTCTCTGTGG + Intergenic
1194412893 X:93578238-93578260 CTGATGCAGGGCAGTCCCTGGGG - Intergenic
1200210492 X:154344859-154344881 AGGTTGCCGGGCCTTCCCTGAGG + Intergenic
1200220360 X:154387233-154387255 AGGTTGCCGGGCCTTCCCTGAGG - Intergenic