ID: 1124755306

View in Genome Browser
Species Human (GRCh38)
Location 15:32400425-32400447
Sequence ATGATGTAGGGCCTTCCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124755299_1124755306 8 Left 1124755299 15:32400394-32400416 CCTCTTACCTCCAGATCTTTCAG 0: 10
1: 12
2: 24
3: 28
4: 252
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755303_1124755306 -2 Left 1124755303 15:32400404-32400426 CCAGATCTTTCAGGGTAGCAGAT 0: 10
1: 13
2: 17
3: 12
4: 129
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755298_1124755306 14 Left 1124755298 15:32400388-32400410 CCAGAGCCTCTTACCTCCAGATC 0: 18
1: 20
2: 6
3: 24
4: 207
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755295_1124755306 21 Left 1124755295 15:32400381-32400403 CCTCCGCCCAGAGCCTCTTACCT 0: 6
1: 13
2: 17
3: 27
4: 270
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755302_1124755306 1 Left 1124755302 15:32400401-32400423 CCTCCAGATCTTTCAGGGTAGCA 0: 10
1: 12
2: 12
3: 20
4: 126
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755296_1124755306 18 Left 1124755296 15:32400384-32400406 CCGCCCAGAGCCTCTTACCTCCA 0: 8
1: 3
2: 0
3: 34
4: 345
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124755297_1124755306 15 Left 1124755297 15:32400387-32400409 CCCAGAGCCTCTTACCTCCAGAT 0: 18
1: 21
2: 6
3: 21
4: 174
Right 1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124755306 Original CRISPR ATGATGTAGGGCCTTCCCTG TGG Exonic