ID: 1124755792

View in Genome Browser
Species Human (GRCh38)
Location 15:32403470-32403492
Sequence CTCCCCTCTCTTAGAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124755792_1124755796 -7 Left 1124755792 15:32403470-32403492 CCACCCACTCTAAGAGAGGGGAG No data
Right 1124755796 15:32403486-32403508 AGGGGAGAGGCCTCCCACTCTGG No data
1124755792_1124755799 5 Left 1124755792 15:32403470-32403492 CCACCCACTCTAAGAGAGGGGAG No data
Right 1124755799 15:32403498-32403520 TCCCACTCTGGAAGAGAAGAGGG No data
1124755792_1124755798 4 Left 1124755792 15:32403470-32403492 CCACCCACTCTAAGAGAGGGGAG No data
Right 1124755798 15:32403497-32403519 CTCCCACTCTGGAAGAGAAGAGG No data
1124755792_1124755803 10 Left 1124755792 15:32403470-32403492 CCACCCACTCTAAGAGAGGGGAG No data
Right 1124755803 15:32403503-32403525 CTCTGGAAGAGAAGAGGGGCCGG No data
1124755792_1124755801 6 Left 1124755792 15:32403470-32403492 CCACCCACTCTAAGAGAGGGGAG No data
Right 1124755801 15:32403499-32403521 CCCACTCTGGAAGAGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124755792 Original CRISPR CTCCCCTCTCTTAGAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr