ID: 1124756458

View in Genome Browser
Species Human (GRCh38)
Location 15:32410650-32410672
Sequence CTCCGTTTACAGATGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124756458_1124756463 8 Left 1124756458 15:32410650-32410672 CCTTGGCCCATCTGTAAACGGAG No data
Right 1124756463 15:32410681-32410703 GGCTCTGAAGAGAAGAGTCAGGG No data
1124756458_1124756464 15 Left 1124756458 15:32410650-32410672 CCTTGGCCCATCTGTAAACGGAG No data
Right 1124756464 15:32410688-32410710 AAGAGAAGAGTCAGGGACTGAGG No data
1124756458_1124756462 7 Left 1124756458 15:32410650-32410672 CCTTGGCCCATCTGTAAACGGAG No data
Right 1124756462 15:32410680-32410702 AGGCTCTGAAGAGAAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124756458 Original CRISPR CTCCGTTTACAGATGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr