ID: 1124764576

View in Genome Browser
Species Human (GRCh38)
Location 15:32478221-32478243
Sequence AAGGCTAAAAAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124764570_1124764576 -3 Left 1124764570 15:32478201-32478223 CCACACTTCCCACTGTTGAAAAG No data
Right 1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124764576 Original CRISPR AAGGCTAAAAAGAAGGAAGA GGG Intergenic
No off target data available for this crispr