ID: 1124768374

View in Genome Browser
Species Human (GRCh38)
Location 15:32507958-32507980
Sequence CCATTTCCTCAGGCAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124768368_1124768374 -5 Left 1124768368 15:32507940-32507962 CCTTACGGGAGGCCATTCCCATT No data
Right 1124768374 15:32507958-32507980 CCATTTCCTCAGGCAGTGCAGGG No data
1124768367_1124768374 4 Left 1124768367 15:32507931-32507953 CCACAGCTGCCTTACGGGAGGCC No data
Right 1124768374 15:32507958-32507980 CCATTTCCTCAGGCAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124768374 Original CRISPR CCATTTCCTCAGGCAGTGCA GGG Intergenic
No off target data available for this crispr