ID: 1124780376

View in Genome Browser
Species Human (GRCh38)
Location 15:32625961-32625983
Sequence GCATCCTTCTCATCTAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124780376_1124780378 -1 Left 1124780376 15:32625961-32625983 CCTATTCTAGATGAGAAGGATGC 0: 2
1: 0
2: 0
3: 12
4: 130
Right 1124780378 15:32625983-32626005 CTATGAAGAAAGGTTTGTGTAGG 0: 2
1: 0
2: 1
3: 26
4: 236
1124780376_1124780379 0 Left 1124780376 15:32625961-32625983 CCTATTCTAGATGAGAAGGATGC 0: 2
1: 0
2: 0
3: 12
4: 130
Right 1124780379 15:32625984-32626006 TATGAAGAAAGGTTTGTGTAGGG 0: 2
1: 0
2: 1
3: 25
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124780376 Original CRISPR GCATCCTTCTCATCTAGAAT AGG (reversed) Intronic
904488080 1:30840777-30840799 GCAGCCTTCTCATCTATAAAAGG + Intergenic
908754143 1:67452511-67452533 ACATCTTTCACATCTAGAAAAGG - Intergenic
910500465 1:87884279-87884301 GCATCCCCATCATATAGAATTGG + Intergenic
911891222 1:103374518-103374540 ACATTCTTTTCATCTGGAATGGG - Intergenic
913195796 1:116454967-116454989 GCATCCTTCTCATTCAGCACAGG - Intergenic
917252843 1:173080567-173080589 CCATTCTTCTCATCTACAAATGG + Intergenic
919646843 1:200103723-200103745 GCCTCCTTCTCCTCTAGCCTAGG - Intronic
1065090908 10:22232613-22232635 GTATCCTTCTCATATAAAACTGG + Intergenic
1069167450 10:65180113-65180135 GCATTCTTCTCATCTGGACATGG - Intergenic
1073749152 10:106504362-106504384 TCAGCCATCTCCTCTAGAATGGG + Intergenic
1079644765 11:22849740-22849762 GCCTCCTTCTCACCTACAAGTGG - Intronic
1080958934 11:37135106-37135128 GCATTCTTCTCATCTACACGTGG + Intergenic
1085061621 11:73452565-73452587 GCCTCCTTCTCTTCTAGCACTGG - Intronic
1086176984 11:83902616-83902638 GCAACCTCCTCATCTGAAATGGG + Intronic
1087303358 11:96460513-96460535 GCAGCCTTACCATCTGGAATAGG - Intronic
1088590931 11:111402541-111402563 GTATCCTTGGCACCTAGAATAGG + Intronic
1096483502 12:51959509-51959531 GCTGCCTTCTCATCTAGGATTGG - Intronic
1097903380 12:64895754-64895776 GCAGCCTTCTGAGCCAGAATAGG - Intergenic
1100366056 12:93921876-93921898 CCATCCTTCAGACCTAGAATTGG + Intergenic
1107725102 13:43291330-43291352 GCCACCTTCTCTTCTAGAACAGG + Intronic
1111783453 13:92757570-92757592 GCATCCTACTCATCTGAAAAAGG + Intronic
1111874797 13:93879803-93879825 GCATCCTACTCATCTGAAAAAGG + Intronic
1111909483 13:94294355-94294377 CCATCCTGCTCATCTTTAATGGG - Intronic
1112152972 13:96784319-96784341 GCAGCCTGCTCATCAGGAATTGG + Intronic
1116000164 14:39234520-39234542 GCAGCCTTCTGAGCCAGAATAGG - Intronic
1116139333 14:40970456-40970478 GCATCCTTCTCTCTTAGAAGAGG + Intergenic
1116496574 14:45568022-45568044 TCATCCATCTCTTCTGGAATTGG + Intergenic
1119698256 14:76731508-76731530 TCATTCTTGTCATCAAGAATAGG - Intergenic
1124546771 15:30635961-30635983 GCATCCTTCTCATCTAGAATAGG - Intronic
1124780376 15:32625961-32625983 GCATCCTTCTCATCTAGAATAGG - Intronic
1131982107 15:98004267-98004289 GCATCGTTCCCATTTAGAACAGG + Intergenic
1134837986 16:17377784-17377806 GGAACCATCTCATCTAGAAAGGG + Intronic
1137538410 16:49344839-49344861 GCATCCTTCTGATTTCAAATTGG + Intergenic
1140931230 16:79630241-79630263 GCAGCCTCCTCAGCTAGACTAGG - Intergenic
1144796380 17:17894068-17894090 GCATCCTTCTCATGCAAAACTGG - Intronic
1147817626 17:43221451-43221473 GCAGCCTCCTCTTCTAGAGTGGG + Intergenic
1149681295 17:58509065-58509087 GCATACTTATCCTCTCGAATGGG + Intronic
1150996162 17:70319976-70319998 TAATACATCTCATCTAGAATGGG - Intergenic
1155531099 18:26767320-26767342 ACATTCTTCTCATCAAGAGTTGG - Intergenic
1157110324 18:44814460-44814482 GCTTCTTACACATCTAGAATTGG + Intronic
1162507103 19:11092150-11092172 GCAACCGACCCATCTAGAATTGG - Intronic
1168390943 19:56007390-56007412 ACTTCCCTCTCATCTGGAATAGG - Intronic
928623384 2:33114220-33114242 GCATCCGTATCATCTAGAGTAGG + Intronic
929434984 2:41921898-41921920 GCCTCCTTCTCACCTGGAAACGG - Intergenic
929666083 2:43835040-43835062 GTATCCTTATCACCTAGAACAGG - Intronic
933533017 2:83534607-83534629 GCATGATTCTCATTTAGATTTGG - Intergenic
933588025 2:84200975-84200997 GCATCCTTGTCATATTGCATTGG - Intergenic
933912579 2:86956277-86956299 TCATCCATCTCATCCAGAAGAGG + Intronic
934010416 2:87813617-87813639 TCATCCATCTCATCCAGAAGAGG - Intronic
935315271 2:101827273-101827295 GCCTACATGTCATCTAGAATGGG + Intronic
935773983 2:106454327-106454349 TCATCCATCTCATCCAGAAGAGG - Intronic
935906080 2:107841586-107841608 TCATCCATCTCATCCAGAAGAGG + Intronic
935992551 2:108734104-108734126 TCATCCATCTCATCCAGAAGAGG + Intronic
936127866 2:109806738-109806760 TCATCCATCTCATCCAGAAGAGG + Intronic
936216831 2:110564747-110564769 TCATCCATCTCATCCAGAAGAGG - Intronic
936425970 2:112419328-112419350 TCATCCATCTCATCCAGAAGAGG - Intronic
937493803 2:122397376-122397398 GCATCTTTCTCATCTCTAAGTGG - Intergenic
938594180 2:132769725-132769747 GCATCCTTTGCAGCTAGGATTGG + Intronic
939233091 2:139455398-139455420 GCAGCCTGCTCAGCTAGGATTGG - Intergenic
939834937 2:147118370-147118392 GAGTCCTTCTCATTTGGAATGGG + Intergenic
941724527 2:168846858-168846880 TCATTCGTCTCATCTAGAGTGGG - Intronic
942896233 2:181057857-181057879 TAATCCTTCTCCTCTAAAATCGG + Intronic
943827583 2:192414815-192414837 GCATTCCTCTCATCCAGAAACGG + Intergenic
946555916 2:220857040-220857062 TCAGCGTTCTCATATAGAATGGG - Intergenic
948328292 2:237144123-237144145 GCATCCTTCTCAGAGAAAATAGG + Intergenic
1171147064 20:22794195-22794217 TCTTCTTTCTCATCTAGAAAAGG - Intergenic
1172468451 20:35174291-35174313 TCATCCGTCTCATCTAGACTGGG - Intronic
1175838897 20:62014390-62014412 CCATCCGTCCCATCTAGGATGGG - Intronic
1177328379 21:19623717-19623739 GCAGCCTTCTCAACCAGAGTAGG - Intergenic
1182370330 22:29806038-29806060 GCAGCCATCTCCTCTAGAAAAGG + Intronic
1183980478 22:41536922-41536944 GCAGCCTCCTCAGCTAGAGTTGG - Intronic
949501674 3:4686113-4686135 GCAGCTCTCTCATCTAAAATGGG - Intronic
949663225 3:6306006-6306028 GCATCCTTCTCATCTGTACATGG + Intergenic
950317271 3:12014200-12014222 GCATCCTTAGCATCCAGCATAGG + Intronic
954987343 3:54807293-54807315 GCAACCTTCTCATCTAACAAAGG + Intronic
956363472 3:68473591-68473613 GCATCCTTCCCAACCAGAATTGG + Intronic
957682036 3:83449387-83449409 GCATTCTTCTAACCCAGAATAGG - Intergenic
959007794 3:101040232-101040254 TCATGCTTCTCATCTAGCTTTGG + Intergenic
962114497 3:132488316-132488338 GCAACCTTCTCAACAAGGATAGG - Exonic
963081095 3:141394343-141394365 GCATCCTCAGCATGTAGAATAGG - Intronic
967383292 3:188884172-188884194 TCAGCTTTCTCTTCTAGAATAGG - Exonic
967386760 3:188919631-188919653 GAATTCTTCTCATCCAGGATGGG - Intergenic
970896652 4:21111500-21111522 AAGTCCTTCTCATCTAGAACAGG + Intronic
972706646 4:41551134-41551156 ACTTACTTCTCATCTTGAATGGG - Intronic
972820244 4:42693517-42693539 GCATCATTCTTATCAAGGATGGG - Intergenic
972827961 4:42783526-42783548 ACATCCTTCTCATCTGCACTTGG - Intergenic
973105344 4:46329060-46329082 GCATCTTTCTTCTCTAGATTTGG + Intronic
975516417 4:75253360-75253382 CCATCATTCTCATCAAGAAGAGG + Intergenic
976910240 4:90296394-90296416 GCATCCTACTCATCTGGCAAAGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978127719 4:105154521-105154543 GTATCCTTCTCATCTATAAGAGG - Intronic
978650652 4:111000233-111000255 TCATCCTTCTCATGTGTAATGGG + Intergenic
978921344 4:114186779-114186801 GCATTCTTCTCATCTAGTCAGGG - Intergenic
984310179 4:178048230-178048252 GCATCCTTTTCATCTGAATTTGG - Intergenic
984521054 4:180801398-180801420 GTGTCATTCTCATCAAGAATGGG + Intergenic
989510464 5:42281108-42281130 CCATCCTTCTCAACTAGATAGGG - Intergenic
992034411 5:72758401-72758423 GCATCCTTATCTTTTAGTATAGG - Intergenic
992430020 5:76701536-76701558 GCACCTTTCTCATTTAAAATAGG + Intronic
992935221 5:81696231-81696253 GAATCCTTCGCACCTAGAAAAGG - Intronic
994303521 5:98175491-98175513 GTATCCTTCTTTTCTAGAGTGGG + Intergenic
999805298 5:155075433-155075455 GCTTCCTTCTTCTGTAGAATTGG - Intergenic
1000058362 5:157629967-157629989 GTATCCTTCTTATATAAAATAGG + Intronic
1000075558 5:157782051-157782073 CCATACTTGTCATATAGAATAGG - Intergenic
1003428002 6:6010223-6010245 GCATACTGCTCATCCAGACTAGG - Intergenic
1007247271 6:40471602-40471624 TCATCCTTCTAATATAGTATTGG - Intronic
1007706178 6:43792788-43792810 TCAACTTTCTCATCTAAAATGGG + Intergenic
1008968772 6:57342186-57342208 GAATCCTTATCATGTAGTATAGG + Intronic
1009157755 6:60244004-60244026 GAATCCTTATCACGTAGAATGGG + Intergenic
1011999917 6:93641397-93641419 TCTTCCTTATCATCTAGCATTGG + Intergenic
1014022680 6:116609045-116609067 ACATTCTTCTCATCTAGACATGG + Intergenic
1015805561 6:137104938-137104960 CCATACTTCTCATCATGAATGGG + Intergenic
1016393769 6:143601222-143601244 TCTTCCTTCTCCTCCAGAATTGG - Intronic
1018107207 6:160500411-160500433 GCAACCTTCACTTCAAGAATCGG + Intergenic
1020220206 7:6230668-6230690 GGATCCTTCTCATGTAGTAAAGG - Intronic
1023818119 7:43965689-43965711 GCATCCTTCTCATCCCGGCTGGG - Intergenic
1028711480 7:93914254-93914276 GCATTCTCTTCATCTAGAAAAGG + Intergenic
1028711794 7:93917966-93917988 GCATTCTCTTCATCTAGAAAAGG + Intergenic
1029742746 7:102500522-102500544 GCATCCTTCTCATCCTGGCTGGG - Intronic
1029760736 7:102599683-102599705 GCATCCTTCTCATCCTGGCTGGG - Intronic
1029965733 7:104738219-104738241 TCATCCTTTTTATCTAGAAAGGG - Intronic
1030087204 7:105826734-105826756 GCCTCCTTCTCATTTAGACCTGG - Intronic
1034004043 7:147449342-147449364 GCAACGTTCTCATCTAGTGTGGG + Intronic
1037686261 8:21142010-21142032 GCCTGCTTCTCATCTGGAATAGG - Intergenic
1038942381 8:32319435-32319457 GCCTTCTTCTCCTCTTGAATAGG - Intronic
1039080031 8:33724989-33725011 GCTTTCTTCTCAGCTAGATTGGG + Intergenic
1043551327 8:81376207-81376229 GCATCCATCCCTTCTGGAATAGG - Intergenic
1045066882 8:98455870-98455892 GCATCCATCGCATCCAGAATGGG + Exonic
1045147162 8:99359737-99359759 CCATACTTTTCATTTAGAATGGG - Intronic
1046720234 8:117610944-117610966 GCAGCCTTCTGAGCCAGAATAGG + Intergenic
1047298095 8:123588901-123588923 ACAACCTTCTCACCTAGAAGAGG + Intergenic
1048684458 8:136888475-136888497 GCATCCTTAACATTTACAATGGG - Intergenic
1055817552 9:80224737-80224759 GCATCCTTTTCATCCAGAAATGG - Intergenic
1058132843 9:101272737-101272759 GCATTTTTCTCATATAAAATTGG + Intronic
1058351000 9:104023748-104023770 GCATCCTTTACATCTAGGTTTGG - Intergenic
1061736430 9:132663315-132663337 GCAGCATTCTCATTTGGAATGGG - Intronic
1185767439 X:2737067-2737089 TCATCCTTCTCAGGTTGAATTGG - Intronic
1186283983 X:8024484-8024506 TCTTCCTTCTGATCTAGAAGTGG + Intergenic
1191684724 X:63878592-63878614 GCAGCCTTCTCATCCAGGATTGG + Intergenic
1192192711 X:69002106-69002128 ACATCCTTGTCTTCTAGAATGGG + Intergenic
1194934956 X:99937919-99937941 TCATCCTCCTCATCTTGAGTAGG - Intergenic
1195737867 X:108032392-108032414 GCATCCTAATCACCTAGAACAGG - Intergenic
1197309377 X:124884585-124884607 GCAGCCTGCTCAGCTGGAATGGG - Intronic
1201442137 Y:14019794-14019816 TCTTCCTTCTTATCTAGAATTGG - Intergenic
1202139637 Y:21708203-21708225 GCATCGTTGCCATCTAGAAATGG + Intergenic