ID: 1124780376

View in Genome Browser
Species Human (GRCh38)
Location 15:32625961-32625983
Sequence GCATCCTTCTCATCTAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124780376_1124780379 0 Left 1124780376 15:32625961-32625983 CCTATTCTAGATGAGAAGGATGC 0: 2
1: 0
2: 0
3: 12
4: 130
Right 1124780379 15:32625984-32626006 TATGAAGAAAGGTTTGTGTAGGG 0: 2
1: 0
2: 1
3: 25
4: 309
1124780376_1124780378 -1 Left 1124780376 15:32625961-32625983 CCTATTCTAGATGAGAAGGATGC 0: 2
1: 0
2: 0
3: 12
4: 130
Right 1124780378 15:32625983-32626005 CTATGAAGAAAGGTTTGTGTAGG 0: 2
1: 0
2: 1
3: 26
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124780376 Original CRISPR GCATCCTTCTCATCTAGAAT AGG (reversed) Intronic