ID: 1124784107

View in Genome Browser
Species Human (GRCh38)
Location 15:32663306-32663328
Sequence GACTGAGGGAAGGAGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 951
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 865}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124784107_1124784112 -4 Left 1124784107 15:32663306-32663328 CCTCCTTACTCCTTCCCTCAGTC 0: 1
1: 0
2: 4
3: 81
4: 865
Right 1124784112 15:32663325-32663347 AGTCTCCTTTCCCCAGACCCTGG 0: 1
1: 0
2: 8
3: 51
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124784107 Original CRISPR GACTGAGGGAAGGAGTAAGG AGG (reversed) Intronic
900681772 1:3920428-3920450 GACGGAGGGAGGGAGTGAGAGGG - Intergenic
900682467 1:3924521-3924543 GACCCTGGGAAGGAGGAAGGAGG - Intergenic
900969359 1:5980896-5980918 GACTGAGGGGAAGAGGGAGGAGG - Intronic
901001389 1:6150621-6150643 GACTGAGGGAAGGAGGGAGAAGG + Intronic
901592181 1:10353770-10353792 GAAAGAGGGAAGGAGTGAGAGGG + Intronic
901771359 1:11531944-11531966 GAGGGAGGGAAGGGGAAAGGTGG - Intronic
901778241 1:11575406-11575428 GGCTGTGGGAAGGGGGAAGGAGG - Intergenic
902098526 1:13966187-13966209 GAGGGAGGGAAGGAGTAGGAGGG - Intergenic
902628351 1:17689607-17689629 GAAGGAGGGAGGGAGGAAGGAGG - Intronic
902955351 1:19921456-19921478 GGCTGAGGGGAGGAGGCAGGTGG - Intronic
903149676 1:21397966-21397988 GAGGGAGGAAAGGAGGAAGGGGG - Intergenic
903331602 1:22599732-22599754 GAAGGAGGGAGGGAGGAAGGAGG + Intronic
903674230 1:25054348-25054370 GATGGAAGGAAGGAGAAAGGAGG - Intergenic
903799464 1:25955732-25955754 GAAGGAGGGAAGGAAGAAGGAGG + Intergenic
904315275 1:29656108-29656130 CACTCAGGGAAGGAGGCAGGAGG - Intergenic
904337972 1:29810335-29810357 TAGTGAGGGAAGGAAGAAGGTGG - Intergenic
904353599 1:29924551-29924573 GAAGGAGGGAAGGAGGGAGGGGG - Intergenic
904390746 1:30184256-30184278 GACTGTGGGAAAGAGGGAGGGGG - Intergenic
904985433 1:34544285-34544307 CACTGAGGGAAGGAAGAAGATGG - Intergenic
905146095 1:35887813-35887835 GACTAAGGAAAAGAGAAAGGGGG - Intronic
906172682 1:43740854-43740876 GAGTGAGGGAGGGAGGAAGAGGG + Intronic
906802484 1:48750004-48750026 GCCTGAGGGTAGGAGTTATGAGG + Intronic
907537019 1:55171987-55172009 CACTGAGGGCAGAAGTCAGGAGG + Intronic
907826755 1:58025072-58025094 GAGTGAGGGAAGGAAGGAGGAGG - Intronic
907835733 1:58106862-58106884 GAGAAAGGGAAGGAGGAAGGAGG - Intronic
907844303 1:58189949-58189971 GAGTGAGGAAAGGAAAAAGGAGG - Intronic
908751628 1:67429933-67429955 GATGGAGGGAAGGAGCGAGGGGG - Intronic
908774725 1:67628730-67628752 GTCTGAGGAAAGGAGTAGAGGGG - Intergenic
909389277 1:75100037-75100059 GAGGAAGGGAAGGAGTAGGGGGG - Intergenic
909427252 1:75540211-75540233 GACTGAGGTAAGGATTAAATTGG - Intronic
909663289 1:78107158-78107180 GAGGGAGGGAGGGAGCAAGGGGG - Intronic
909698784 1:78496581-78496603 AAAGGAGGAAAGGAGTAAGGTGG + Intronic
909772184 1:79437701-79437723 GAGAGAGTGAAGGAGGAAGGAGG - Intergenic
909869321 1:80719154-80719176 GAAGGAAGGAAGGAGGAAGGAGG - Intergenic
910135676 1:83966343-83966365 GACAGAGGGAAGGAGGAGGGAGG - Intronic
910291294 1:85602755-85602777 GACTCAGGGTAGGAGTAAAGGGG - Intergenic
910472487 1:87570229-87570251 GAGTCAGGGAGGGAGAAAGGGGG - Intergenic
910499729 1:87876359-87876381 GAGGGAGGGAGGGAGGAAGGAGG - Intergenic
910536236 1:88300964-88300986 GGCTGAGGCAAGGAATAAAGAGG - Intergenic
910994767 1:93092617-93092639 GAATGAGGAGAGGAATAAGGGGG + Intronic
911154941 1:94628064-94628086 GACTTAGGGAACAAGAAAGGTGG + Intergenic
912160148 1:106972994-106973016 GACTGAGTGAAGTAGTTAGTTGG - Intergenic
912355098 1:109048430-109048452 GAGTGAGGGAGGGAGGGAGGAGG + Intergenic
912578642 1:110700005-110700027 GACTGAGGGAAGAGGAAATGGGG + Intergenic
912728862 1:112083522-112083544 TCCTGGGGGAAGGAGAAAGGAGG + Intergenic
912730006 1:112093789-112093811 GAATGAGGGAGGGAGGAAGGAGG + Intergenic
913115602 1:115693537-115693559 GACTGGGAGAAAGAGGAAGGGGG - Exonic
913144746 1:115977579-115977601 GACTGAAGGAAAGAGTAAAATGG - Intronic
913231354 1:116743013-116743035 GTCTGTGGGAAGGTGTAATGAGG + Intergenic
913683140 1:121206197-121206219 GTCTGGGGGAAGGAGCATGGGGG - Intronic
913708188 1:121449397-121449419 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
914242899 1:145864014-145864036 GACTGAGAGAAGGAATGGGGAGG + Intergenic
914739055 1:150447962-150447984 AACTGGGAGAAGGAGAAAGGCGG - Intronic
914960110 1:152197521-152197543 GAGAGAAGGAAGGAGGAAGGGGG - Intergenic
915043625 1:152991480-152991502 GAATGAGTGAAGGAGTAAAAGGG - Intergenic
915129274 1:153685954-153685976 TTCTGAGGGAAGGAGTAAGCTGG + Intronic
915485619 1:156218434-156218456 GGCTGAGAAAAGGAGTCAGGAGG - Intronic
917208487 1:172604668-172604690 GACTGAGAGAGGGAGAAAAGGGG - Intronic
917657654 1:177142870-177142892 GCCAGAGGAAAGGAGCAAGGAGG + Intronic
918144681 1:181745088-181745110 GAGTTTGGGAGGGAGTAAGGAGG + Intronic
918390495 1:184054834-184054856 GGCTGAGGGAAGCAGTGATGGGG - Exonic
919258212 1:195154207-195154229 GAAAGAGGGAAGGAGGAAAGGGG - Intergenic
919347995 1:196411027-196411049 GAGGGAGGGAGGGAGGAAGGTGG - Intronic
919572837 1:199270103-199270125 AAATGAGGGAAGAAGAAAGGAGG - Intergenic
919935102 1:202245999-202246021 GACAGAGGGAAGGAGGGATGGGG - Intronic
920537951 1:206752551-206752573 GAGGGAGGGAGGGAGGAAGGAGG - Intergenic
920926116 1:210343371-210343393 GACTGAAGGAAGGAGGACGAAGG - Intronic
921202495 1:212820980-212821002 AACTGAGGGAAGTATTAGGGAGG + Intergenic
921338345 1:214110233-214110255 AACTGAGGCAAGGAGTAAAACGG + Intergenic
923129678 1:231064645-231064667 GAAGGAGGGAAGGAGAAGGGAGG - Intergenic
923300441 1:232635432-232635454 GAGAGAGGGAGGGAGGAAGGAGG + Intergenic
924005132 1:239600713-239600735 GAGGGAGGGAAGAAGGAAGGAGG - Intronic
924573866 1:245261537-245261559 GACGGAGGGAGGGAGAGAGGGGG - Intronic
924581934 1:245330636-245330658 GAGTGGGGGAGGGAGTAGGGGGG + Intronic
924606222 1:245537947-245537969 GATTGAGTGAAGCAGTAAAGAGG + Intronic
924616688 1:245617900-245617922 GCCTGTGGGAAGGAGCAGGGGGG - Intronic
924633400 1:245763207-245763229 TATTGAGGGAAGGAGGAGGGAGG - Intronic
1063040167 10:2329662-2329684 GACGGAGGGAAGGGGTTGGGAGG + Intergenic
1064179014 10:13099424-13099446 GAGGGAGGGAAGGAGGGAGGGGG - Intronic
1064217415 10:13411971-13411993 GACTGAGGGGAGGGGAAATGGGG - Intergenic
1064477524 10:15707025-15707047 GAGTGAGGAAAGGAGCCAGGTGG - Intronic
1065001799 10:21343984-21344006 GAGGGAGGGAAGGAGGGAGGGGG + Intergenic
1065242278 10:23718830-23718852 GATTGAGGGAGGGAGGGAGGGGG + Intronic
1065492417 10:26295043-26295065 GGCTGAGGGATGGAGCAAGATGG + Intronic
1065515907 10:26524116-26524138 AAATGCGGGAAGGAGAAAGGAGG - Intronic
1065708777 10:28495390-28495412 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1065896815 10:30170294-30170316 GAGGGAGGGAAGGAGAAAGTGGG + Intergenic
1066170830 10:32842931-32842953 GACTTGGGGAAAGAGTAGGGGGG + Intronic
1067044513 10:42976707-42976729 GCCTGAGGGAAGGAGTACTGTGG + Intergenic
1067269704 10:44779773-44779795 GATTGAGGGACAGAGCAAGGAGG - Intergenic
1067667261 10:48289038-48289060 GAGGGTGGGAAGGAGCAAGGAGG - Intergenic
1068058504 10:52038283-52038305 AACTGAGGGAAGGGGTTCGGGGG + Intronic
1068247151 10:54387963-54387985 GACTTGGGGAGGGAGTAATGGGG + Intronic
1068332676 10:55591656-55591678 GTATCAGGGGAGGAGTAAGGAGG + Intronic
1068934439 10:62622279-62622301 GCCTGAGGCAGGGAGGAAGGAGG - Intronic
1070130737 10:73653721-73653743 GATGGAGGGAAGAGGTAAGGGGG + Intronic
1070702409 10:78613390-78613412 GAATGAGGGAGGGATGAAGGAGG + Intergenic
1070702468 10:78613560-78613582 GAAAGGGGGAAGGAGGAAGGGGG + Intergenic
1070771222 10:79083410-79083432 GAGTGAGGGAAGGAGAGAGTGGG + Intronic
1071842431 10:89486309-89486331 GACTGAGTGATGGAGCAGGGAGG - Intronic
1071974132 10:90938169-90938191 GAGTGAGGGAAGGAGAGAGAAGG - Intergenic
1071988584 10:91076922-91076944 GACAGAGGGGAGGAGTAAAGGGG - Intergenic
1072001623 10:91200925-91200947 GACAGAGGGAAGTGGAAAGGGGG + Intronic
1072795740 10:98353161-98353183 GGGAGAGGGAAGGGGTAAGGAGG + Intergenic
1073024062 10:100473429-100473451 GACTGAGGGGAGGAGGAACGGGG - Intronic
1073186178 10:101616299-101616321 GACTGAAGGAAGGAGATAGAAGG - Intronic
1073229091 10:101951905-101951927 GAGGGAGGGAAGGAGGGAGGGGG + Intronic
1073447223 10:103588973-103588995 GAGTGACGGAAGGAGGAAGGAGG + Intronic
1073759224 10:106612345-106612367 GACAGAGGAAAGGAGAAGGGGGG - Intronic
1074208487 10:111305393-111305415 GACTGTGGGAAGGTCTACGGAGG + Intergenic
1074776311 10:116770590-116770612 GACTGAGGCAAGGTGGTAGGAGG + Intergenic
1074816854 10:117148756-117148778 GGCTGATGGAAGCAGGAAGGAGG + Intergenic
1075122678 10:119675824-119675846 GAAGGAGGGAAGGGGGAAGGGGG - Intronic
1075317771 10:121466159-121466181 GACTAAGAGATGGAGTTAGGAGG + Intergenic
1075656239 10:124162997-124163019 GAGGGAGGGAAGGGGGAAGGAGG + Intergenic
1076572422 10:131441353-131441375 GAGGGAGGGAAGGAGTAAGGAGG + Intergenic
1076824210 10:132959157-132959179 GACTGAGGGAGGGAGGACGCTGG - Intergenic
1077163260 11:1123136-1123158 GACGGAGGGAGGAAGGAAGGGGG - Intergenic
1077307141 11:1873510-1873532 GAGGGAGGGAGGGAGGAAGGAGG + Intronic
1077391847 11:2303937-2303959 CCCTGAGGGAAGGAGGAGGGAGG - Intronic
1077779268 11:5307659-5307681 GAAGGAGGGAAGGGGGAAGGGGG - Intronic
1078395087 11:10973952-10973974 GAGTGAGGGCAGGAGCCAGGAGG + Intergenic
1078566238 11:12416784-12416806 GAGGGAGGGAGGGAGAAAGGAGG + Intronic
1079128755 11:17735669-17735691 GAGGGAGGGAGGGAGTGAGGGGG - Exonic
1079312563 11:19379274-19379296 CACTAAGGGAAGTAATAAGGTGG + Intronic
1079355742 11:19729188-19729210 GACTGAGGGAAGGAGGGAACTGG + Intronic
1079370416 11:19847465-19847487 CACTGAGGGAAGAAGGCAGGAGG - Intronic
1079456701 11:20642735-20642757 GACTCAGTGAAGGACTCAGGTGG + Intronic
1079761595 11:24336014-24336036 GAGGGAGGGAAGGAGGGAGGGGG - Intergenic
1079934561 11:26600620-26600642 GAGGGAGGGAAGGAGGGAGGGGG - Intronic
1080056772 11:27914941-27914963 GACACAGGGATGGAGTAAGCTGG + Intergenic
1081057565 11:38429429-38429451 GCATGAGGTAAGGAGCAAGGTGG + Intergenic
1081706997 11:45188116-45188138 TACTGAGGGAGGGAGTGTGGAGG - Intronic
1081967081 11:47176717-47176739 GCCTGAGGGAGGGAGAAGGGCGG - Intronic
1082834441 11:57641158-57641180 GACTGGGAGAAGGAGTGAGGAGG + Intergenic
1083117800 11:60480356-60480378 GACTGGGGGAAGGAGAAAACGGG - Intergenic
1083271514 11:61575213-61575235 GGCTGACTGAAGGAGAAAGGGGG - Intronic
1084028217 11:66466285-66466307 GACTGAGGGGAGGGGAATGGGGG + Intronic
1084742681 11:71149828-71149850 AAGGGAGGGAAGGAGAAAGGAGG + Intronic
1084755843 11:71238039-71238061 GACTGAGGGTGGGACTCAGGGGG + Intronic
1085293580 11:75417734-75417756 GACTCTGGGAAGGGGTCAGGAGG - Intronic
1085300432 11:75455364-75455386 GAGTGAGGGCAGGAGGAAGGTGG + Intronic
1085329700 11:75637821-75637843 GAGGGAGGGAAGTAGGAAGGAGG + Intronic
1085399424 11:76226899-76226921 GGCTGAGGGAAGGGGACAGGGGG - Intergenic
1085523123 11:77149779-77149801 GACTGAGGGACAGAGTGAGAGGG - Intronic
1085648522 11:78245150-78245172 GCCTGAGGGAAGGGGAAATGGGG + Intronic
1085675656 11:78515156-78515178 GACTGGGGGTAGGAGAAATGGGG + Intronic
1085876047 11:80406712-80406734 CACTGAGGCAGGGAGTAGGGAGG - Intergenic
1086571639 11:88291523-88291545 GAGGGAGGGAAGGAGGAAGGAGG + Intergenic
1087287374 11:96279523-96279545 GAGTAAGGGAAGGAGAAAGAGGG + Intronic
1088389201 11:109295302-109295324 GACTGAGGTAATGATTAAGAGGG + Intergenic
1088831732 11:113542454-113542476 GAATGAGAGAAGGAGTCAGGTGG - Intergenic
1088842929 11:113641871-113641893 GACTGATGGCAGGTGTAAGGTGG - Intergenic
1088916590 11:114232477-114232499 GACTGTGGGATGGAGCAAGTAGG - Intronic
1089255693 11:117192774-117192796 GACTGAGGGCAGGGGCAGGGAGG - Intronic
1089556925 11:119320172-119320194 GACCCAGGGCAGGAGGAAGGAGG + Intronic
1090306205 11:125693368-125693390 GAAGGAGGGATGGAGTGAGGTGG - Intergenic
1090549703 11:127806462-127806484 GAGGGAGGGAAGGAAAAAGGAGG - Intergenic
1090800688 11:130169949-130169971 GACTTGGGGCAGGAGGAAGGTGG + Intronic
1091261319 11:134236801-134236823 GGCTGAGGGAAGGAGGAAATGGG + Intronic
1091325027 11:134679629-134679651 AACTGAGTGGAGGAGTCAGGAGG + Intergenic
1091752481 12:3031533-3031555 AACTGAGGCATGGAGTAAGCAGG + Intronic
1091874590 12:3923680-3923702 GAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1091958494 12:4669621-4669643 GAAGGAAGGAAGGAGAAAGGAGG - Intronic
1092002396 12:5043688-5043710 GAGGGAGGGAAGGAGTGGGGAGG - Intergenic
1092217564 12:6693911-6693933 GAAGAAGGGAAGGAGGAAGGTGG + Exonic
1092237997 12:6821785-6821807 GAGAGAGGGAAGGAGGGAGGAGG + Exonic
1092874674 12:12837691-12837713 GAGAGAGGGAAGCAGTGAGGGGG - Intergenic
1093019981 12:14194316-14194338 GAGTGAAGGAAGAAGGAAGGAGG - Intergenic
1093141624 12:15516545-15516567 GAGGGAGGGAAGAAGGAAGGGGG + Intronic
1093152028 12:15633078-15633100 GAGTAAGAGAAGGAGTTAGGTGG + Intronic
1093207420 12:16267680-16267702 GAATGAGGGAATGGGAAAGGAGG - Intronic
1093439385 12:19176201-19176223 GACAGAGGGAGGGAGGAAGGTGG - Intronic
1094133895 12:27103574-27103596 GGCTGAAGGGAGGAGTAATGAGG - Intergenic
1094494029 12:30978374-30978396 CAAAGAGGGAAGGAGTAAGTGGG + Intronic
1094724018 12:33093811-33093833 GACTGAGGAGGGGAGGAAGGAGG - Intergenic
1096250402 12:50028367-50028389 GACAGGGGGAAGGAGAAAAGTGG - Intronic
1096294590 12:50372937-50372959 GAAGGAAGGAAGGAGGAAGGAGG + Intronic
1096783454 12:54003958-54003980 GAAGGAGGGAAGGAGAAAGATGG + Intronic
1097825664 12:64172533-64172555 GACTGAAGGAAGAAGGGAGGAGG + Intergenic
1098109078 12:67102610-67102632 GAATAAGGAAAGGAGCAAGGAGG - Intergenic
1098430453 12:70413877-70413899 GACTGAGGGAAGTGGAAAGTGGG + Intronic
1099134904 12:78885309-78885331 GAGGGAGGGAAGAAGGAAGGAGG + Intronic
1099236487 12:80088530-80088552 GACTGAGAGGAGGAGAAAGCTGG - Intergenic
1100100802 12:91102174-91102196 CAGTGAGTGAAGGAGTAAGTGGG + Intergenic
1100137645 12:91573282-91573304 GACTGATGGATGGGGTGAGGTGG - Intergenic
1101348573 12:103907237-103907259 GACAGAGGGAAGGAGACAGAGGG + Intergenic
1101623750 12:106417855-106417877 GAATAAGGAATGGAGTAAGGAGG + Intronic
1102033952 12:109760420-109760442 GACTGAGAGCAGGAGCCAGGGGG + Intronic
1102500953 12:113352232-113352254 GACGGAGGGGAGGGGTAAGGAGG - Intronic
1102552782 12:113703806-113703828 GAGTGAGGGAAAGAGGCAGGAGG - Intergenic
1102992147 12:117322846-117322868 GAGGGAGGGAGGGAGTAAGGAGG - Intronic
1103239070 12:119398122-119398144 GGCAGAGGGGAGGAGGAAGGCGG + Intronic
1103251625 12:119504983-119505005 AAAGGAGGGAAGGAGGAAGGTGG - Intronic
1103458443 12:121085638-121085660 GATTTGGGAAAGGAGTAAGGAGG - Intergenic
1103547742 12:121713630-121713652 GAGTGAGGGCGGGTGTAAGGCGG + Intronic
1103867199 12:124062616-124062638 AACTGAGGGCAGGAAGAAGGAGG + Intronic
1103956774 12:124581877-124581899 GAAAGAGGGAGGGAGGAAGGAGG + Intergenic
1104165989 12:126230149-126230171 GAGTGAGTGAAGGAGCAATGAGG + Intergenic
1104172505 12:126295845-126295867 GAAAGAGGGAAGGGGGAAGGAGG + Intergenic
1104398521 12:128456077-128456099 GCCTGAGTGAAGGAGAGAGGAGG + Intronic
1104575666 12:129963811-129963833 GACGGAGGGCAGGAGTAGAGAGG - Intergenic
1104683792 12:130771258-130771280 GAATTAGGGAAGCAGTAAGGAGG - Intergenic
1104764539 12:131318081-131318103 GAGTGAGTGAATGAGTAATGAGG + Intergenic
1104942897 12:132403217-132403239 GACTCTGGGAAGGAGAGAGGGGG + Intergenic
1105623818 13:22093965-22093987 GACTAAGGGAAGGAGGCATGGGG + Intergenic
1105727579 13:23180017-23180039 GAAGGAGGGAGGGAGAAAGGTGG - Intergenic
1106019559 13:25901266-25901288 GAATAAGGGAAGCAGAAAGGTGG + Intronic
1106731807 13:32549000-32549022 GACTGCGGGAAGGAGGAAATGGG + Intergenic
1106765435 13:32908824-32908846 GAGGGAGGGAAGAAGTAAGATGG - Intergenic
1107610440 13:42107538-42107560 GAGGGAGGGAGGGAGTATGGAGG + Intronic
1107999998 13:45897199-45897221 GAGGGAGGGAAGGAGGAGGGAGG - Intergenic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1108275135 13:48800703-48800725 AACTGGGGGAAGGAGCAGGGAGG + Intergenic
1108533325 13:51347281-51347303 GCCTGAGGGCAGGAGAGAGGAGG + Intronic
1108853843 13:54768926-54768948 GAGGGAGGGAAGGAATAAGGAGG - Intergenic
1108971108 13:56378431-56378453 GAAGGAGGGAAGGGGGAAGGAGG + Intergenic
1109613955 13:64806788-64806810 GACTTAGAGAAGAAGAAAGGAGG + Intergenic
1110156445 13:72322478-72322500 GAAAGAGGGAAGGAGGGAGGAGG + Intergenic
1110345955 13:74448068-74448090 GAGAGAGGAAGGGAGTAAGGAGG + Intergenic
1111084154 13:83351876-83351898 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1111251809 13:85611206-85611228 GATAGAAGGAAGGAGTAGGGTGG - Intergenic
1111533825 13:89575714-89575736 TACTGAGGAGAGGAGGAAGGAGG - Intergenic
1111821997 13:93226804-93226826 GCAAGAGGGAAGGAGAAAGGAGG - Intergenic
1111912195 13:94325153-94325175 GAGGGAGGGAGGGAGAAAGGAGG + Intronic
1111972262 13:94929018-94929040 GACTGACAGAAGGACTAGGGAGG - Intergenic
1113186127 13:107687308-107687330 GAGGGAGGGAAGGAGGGAGGGGG + Intronic
1113314451 13:109163515-109163537 GAGGGAGGGAAGGAGGGAGGTGG - Intronic
1113475230 13:110575950-110575972 GAGGGAGGGAAGGAGAGAGGTGG - Intergenic
1113680687 13:112242234-112242256 GATGGAGGGAAGGAGGAAGAAGG + Intergenic
1113850395 13:113414410-113414432 GACTGAGGGAGGGAGGGTGGGGG - Intergenic
1115114006 14:29857725-29857747 GGCTGCGGGGAGGAGAAAGGAGG + Intronic
1115115007 14:29869956-29869978 GAATGAGGAAAGGAGAAAGTGGG - Intronic
1115271722 14:31560331-31560353 GAAAGAAGGAAGGAGGAAGGAGG - Intronic
1115328869 14:32171928-32171950 ATCTGAGGGTAGGAGTGAGGTGG - Intergenic
1116411516 14:44629408-44629430 GACTGGAGGAAGGAGAAATGTGG + Intergenic
1116470711 14:45282528-45282550 GAGGGAGGGAGGGAGGAAGGGGG - Intergenic
1117079071 14:52132813-52132835 GATTGGGGGAAGGGGGAAGGGGG + Intergenic
1117390676 14:55259535-55259557 GAGTGAGGGAAGAAGTCATGGGG + Intergenic
1117648701 14:57879920-57879942 GAGGGAGAGAAGGAGTGAGGTGG + Intronic
1117746719 14:58877011-58877033 GACAGAGGGATGGAGTGAGAGGG + Intergenic
1118705057 14:68472509-68472531 CCCTGAGGAAAGGAGTAACGGGG - Intronic
1119557793 14:75566915-75566937 AGCAGAGGGAAGGAGGAAGGGGG + Intergenic
1119931445 14:78551629-78551651 GAAAGAAGGAAGGAGAAAGGGGG - Intronic
1120244965 14:81995578-81995600 GACAGAGAGAAGGACTAAGATGG - Intergenic
1120873770 14:89360459-89360481 GAGGGAGGGAAGGAGAAAGAGGG + Intronic
1120903127 14:89593077-89593099 GAATGAGGGAAGGAGGAGGAAGG + Intronic
1121262955 14:92579890-92579912 CACTGTGGGAAGGATTCAGGAGG + Intronic
1121766916 14:96495675-96495697 GAAGGAAGGAAGGAGTAGGGAGG - Intergenic
1122316514 14:100828562-100828584 GACTGAGGAAGGCAGTAGGGAGG - Intergenic
1122460722 14:101892367-101892389 GGCTGAGGGAAGGTGTTGGGTGG + Intronic
1122580300 14:102767626-102767648 GAATGAGTGAATGAGTAAGTGGG - Intergenic
1122723051 14:103732714-103732736 GACTGTGGGCAGGAGGCAGGCGG + Exonic
1123967552 15:25474116-25474138 GAATGAGGAAAGGAATAAAGTGG + Intergenic
1124457353 15:29856437-29856459 GACTGGGGGAAGGGGGAATGGGG + Intronic
1124478543 15:30058227-30058249 GAGTGAGGGAAAGAGAAGGGCGG + Intergenic
1124784107 15:32663306-32663328 GACTGAGGGAAGGAGTAAGGAGG - Intronic
1125101517 15:35918467-35918489 GATTGGGGGAAGGAAGAAGGGGG + Intergenic
1125540714 15:40468382-40468404 GAGTGAGGGAAGGAGACAGAGGG + Intergenic
1126108102 15:45160230-45160252 GACTGAGGGGAGGCCTGAGGAGG + Intronic
1126724960 15:51622684-51622706 GGCGGAGGGAAGGCGAAAGGGGG - Intronic
1126803937 15:52326543-52326565 GGCTGAGGGAGGGAGGAATGGGG + Intronic
1126822940 15:52522693-52522715 TTCTGAGGTAAGAAGTAAGGCGG + Intronic
1127137558 15:55940492-55940514 GGAGGAGGGAAGGAGGAAGGAGG - Intronic
1127660743 15:61098089-61098111 GAGGGAGGGAAGGAGGAAGGAGG - Intronic
1128273845 15:66335689-66335711 GACTGTGGGTAGGGGTGAGGGGG + Intergenic
1128498335 15:68210710-68210732 GACTGAGGGACGGGGTAGGTAGG + Intronic
1128556584 15:68635859-68635881 GAGTGAGGGAAGGAATAGGAGGG - Intronic
1129903407 15:79169142-79169164 GACAGAGGGAGGGGGGAAGGCGG + Intergenic
1129933125 15:79428497-79428519 GAAGGAGGGAAGGAGGAAGGAGG - Intergenic
1130050635 15:80480814-80480836 GAAAGAGGGAAGGAGGAAGGAGG - Intronic
1130244714 15:82235418-82235440 AACTGAGCTAAGGAATAAGGTGG + Intronic
1130861971 15:87899370-87899392 GGGTGGGGGAAGGAGAAAGGAGG - Intronic
1130955271 15:88623022-88623044 GGCTGAGGCTAGGAGTAGGGTGG - Intronic
1131424595 15:92335204-92335226 GGCTGAGCTAAGGACTAAGGTGG + Intergenic
1131509453 15:93041683-93041705 GACTCAGGGAGGCAGCAAGGAGG - Intronic
1131649871 15:94387126-94387148 GAAGGGGGGAAGGAGGAAGGAGG - Intronic
1131791443 15:95970139-95970161 GAAGGAAGGAAGGAGTAGGGAGG + Intergenic
1131810056 15:96163661-96163683 GAAGGAGGGAAGGAGGAAGAAGG + Intergenic
1131901137 15:97088824-97088846 GAGGGAGGGAAGCAGTGAGGGGG - Intergenic
1131909995 15:97188014-97188036 GAGAGAGGGAGGGAGGAAGGAGG - Intergenic
1132560138 16:589860-589882 GGCTGAGGGAAGGAGGGCGGCGG + Intronic
1133647143 16:7775116-7775138 GAAGGAAGGAAGGAGGAAGGAGG + Intergenic
1133720371 16:8488984-8489006 GAAGGAGGGAAGGAAGAAGGGGG + Intergenic
1133890911 16:9877793-9877815 GGGAGAGGGAAAGAGTAAGGGGG - Intronic
1133981697 16:10637432-10637454 GAGGGAGGGGAGGAGGAAGGAGG + Intronic
1134291710 16:12907038-12907060 GAAGGAGGGAAGGGGGAAGGGGG - Intronic
1134298156 16:12965400-12965422 GGCTGGAGAAAGGAGTAAGGAGG - Intronic
1134316836 16:13126681-13126703 GACTGAGGGAAGAAGAAAGTGGG + Intronic
1134449317 16:14354004-14354026 GGGGGAGGGAAGGAGGAAGGGGG + Intergenic
1134655827 16:15947952-15947974 TAGCGAGGGAAGGAGGAAGGAGG - Intergenic
1134870799 16:17650731-17650753 GACTAAGGGAAGGCATAATGGGG + Intergenic
1134913285 16:18048536-18048558 GAGTGATGGAAGGAGTAGGTGGG - Intergenic
1135831518 16:25778358-25778380 AACTGAGGGCAGGAGGTAGGAGG - Intronic
1135840090 16:25868385-25868407 TACAGAGGGAAGGGGGAAGGGGG - Intronic
1135904647 16:26500133-26500155 GACTGAGGGAAGGTGTAACGGGG - Intergenic
1136268023 16:29132162-29132184 GATGGAGGGAGGGAGGAAGGAGG + Intergenic
1136285545 16:29238386-29238408 GAGAGAGGGAAGAAGGAAGGAGG + Intergenic
1137701952 16:50503745-50503767 GATGGAGGGATGGAGGAAGGCGG - Intergenic
1137720048 16:50622475-50622497 GAAGGAGGGAGGGAGCAAGGAGG - Intronic
1137774054 16:51041005-51041027 GAAGGAGGGAGGGAGGAAGGAGG + Intergenic
1138055887 16:53832838-53832860 AAATGAGGGAAGGAGAAATGGGG - Intronic
1138191557 16:55017743-55017765 GAATGAGGGGAGGAGTACGGGGG + Intergenic
1138486703 16:57349853-57349875 GAAAGAGGGAAGGAGGGAGGAGG - Intergenic
1138498386 16:57423032-57423054 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1139162636 16:64529605-64529627 GAAGGAAGGAAGGGGTAAGGAGG + Intergenic
1139317473 16:66086140-66086162 GATGGAGGGAAGGAGAGAGGAGG + Intergenic
1139560948 16:67741786-67741808 GACAGAGGAAAGGAGCAGGGAGG + Intronic
1139631421 16:68234164-68234186 AAGTGAGGGTAGGAGGAAGGAGG + Intronic
1140221436 16:73047499-73047521 GACTCAGGAAAGGAGGAGGGAGG + Intronic
1140255556 16:73332993-73333015 GAGCAAGGGAAGGAATAAGGAGG - Intergenic
1140315140 16:73889155-73889177 GACTAAGGCAAGGAGAAAGCCGG + Intergenic
1140321028 16:73951879-73951901 GAATGAAGGAAGGACTGAGGGGG - Intergenic
1140814080 16:78604797-78604819 GAAGGAGGGAGGGAGGAAGGAGG - Intronic
1141144654 16:81520548-81520570 GAGGGAGGGAGGGAGGAAGGGGG + Intronic
1141172250 16:81698762-81698784 GACTGAGGCCGGGAGGAAGGGGG - Intronic
1141293937 16:82749177-82749199 GAGAGAGAGAAGGAGGAAGGTGG + Intronic
1141733809 16:85839474-85839496 GACTGAGGGAAGAAGAGACGAGG - Intergenic
1141799996 16:86301065-86301087 GACGGAGGGAAGGAGGAGGTTGG - Intergenic
1142071329 16:88092500-88092522 GAGGGAGGGAGGGAGGAAGGAGG + Intronic
1142090874 16:88208528-88208550 GAGAGAGGGAAGAAGGAAGGAGG + Intergenic
1143085497 17:4413083-4413105 GAATCAGGGCAGGAGGAAGGAGG - Intergenic
1143104571 17:4522567-4522589 GAAAGAGGGAGGGAGGAAGGAGG - Intronic
1143294828 17:5863185-5863207 GAGGGAGGGAGGGAGGAAGGAGG - Intronic
1143477618 17:7211715-7211737 GACTGAGGGAAGGGGGTAGGTGG + Intronic
1143775234 17:9195055-9195077 AAATGAGGGAATGAGGAAGGTGG - Intronic
1143990161 17:10952334-10952356 GACTGAAGGCAGGAGAGAGGAGG + Intergenic
1144278775 17:13703287-13703309 GAGGGAGGGAAGGAGTGGGGGGG + Intergenic
1144719344 17:17457067-17457089 GGCTGAGGGAAGCAGTGATGGGG - Intergenic
1144763644 17:17721533-17721555 GACTGAGGGCAGGAGTTGGTGGG + Intronic
1144919910 17:18754738-18754760 GAGGGAGGGAAGGAGGGAGGAGG + Intronic
1144950002 17:18988951-18988973 GGCTGAGTGAAGGTGCAAGGTGG + Intronic
1145096367 17:20031657-20031679 GGCTGAGGGAGGGAGTAACGTGG - Intronic
1145187422 17:20806967-20806989 GACTGAGGGATGGAGGAAATGGG - Intergenic
1145935147 17:28710982-28711004 AAGGGAGGGAAGGAGTAGGGCGG + Intronic
1146268253 17:31467471-31467493 GACTGAGGGCAGGATGAAGAAGG - Intronic
1146700057 17:34949490-34949512 GAGGGAGGGAAGAAGGAAGGAGG + Intronic
1146851569 17:36226438-36226460 GACTGAGGGATGGAGGAAATGGG + Intronic
1146867476 17:36350314-36350336 GACTGAGGGATGGAGAAAATGGG + Intronic
1147070353 17:37950925-37950947 GACTGAGGGATGGAGAAAATGGG + Intergenic
1147097826 17:38154420-38154442 GACTGAGGGATGGAGGAAATGGG + Intergenic
1147119979 17:38330196-38330218 GACTGCGGGAGAGAGTATGGGGG - Exonic
1147158862 17:38559315-38559337 GACTCAGGGAAGGAGAAGGAGGG + Intronic
1147390076 17:40103672-40103694 GAAGGAAGGAAGGAGCAAGGGGG - Intergenic
1147566763 17:41541228-41541250 AGCAGAGGGAAGGAGTGAGGGGG - Intergenic
1147874862 17:43613959-43613981 GACTGAGTGATGGAGAAGGGAGG + Intergenic
1147881008 17:43653444-43653466 GACAGAGGAAAGGAGAAAAGAGG - Intronic
1148063671 17:44853448-44853470 GACTAAGTGAAGGAGCAAGTGGG - Intronic
1148162090 17:45456068-45456090 GAGAGAGGGAAGGAGTCATGAGG - Intronic
1148431918 17:47649897-47649919 GAGCGAGGGAGGGAGGAAGGCGG - Exonic
1148960401 17:51387760-51387782 GAAAGAGAGAAGGAGTAAGGTGG + Intergenic
1149424947 17:56545975-56545997 GAGGGAGGGAAAGAGGAAGGGGG + Intergenic
1149857051 17:60091867-60091889 GACTGGGGGAAGAAGAAAAGAGG - Intergenic
1150079523 17:62224541-62224563 GACTGAGGGATGGAGGAAATGGG + Intergenic
1150099690 17:62411814-62411836 GAGGGAGGGAGGGAGGAAGGAGG + Intronic
1150254790 17:63735834-63735856 GAATGAGGGAAGGAGAAGTGGGG + Intronic
1150310073 17:64121082-64121104 GAGGGAAGGAAGGAGCAAGGGGG - Intronic
1150393323 17:64802716-64802738 GAGAGAGGGAAGGAGTCATGAGG - Intergenic
1150696689 17:67411537-67411559 GAGTGAGGGCAGGAGAAAGGAGG + Intronic
1151016187 17:70555864-70555886 GAATGAGGGAGGGGGAAAGGAGG + Intergenic
1151050935 17:70978321-70978343 GAAGGAAGGAAGGAGGAAGGAGG + Intergenic
1151164611 17:72192969-72192991 GACTCTGGGAAGAAGTAAGGAGG - Intergenic
1151257109 17:72886441-72886463 CTCTGAGAGAAGGAGAAAGGAGG - Intronic
1151307025 17:73269262-73269284 GAATGAGTGAATGAGTAAGTGGG - Intergenic
1151307029 17:73269330-73269352 GAGTGAGTGAATGAGTAAGTGGG - Intergenic
1151340052 17:73465370-73465392 GGCTGGGGGAAGGGGTCAGGAGG + Intronic
1151343552 17:73487299-73487321 GCCTTATGGAAGGAGCAAGGTGG + Intronic
1151396565 17:73826896-73826918 GACAGAGGGAAGGAGGAATCTGG + Intergenic
1151525314 17:74661734-74661756 GAGAGAGGGAGGGAGGAAGGAGG + Intergenic
1151552684 17:74831133-74831155 GCCTGAGGGAAGGAGGCACGTGG - Intronic
1152243037 17:79170119-79170141 GAAGGAAGGAAGGAGGAAGGAGG + Intronic
1153003065 18:473905-473927 GGCTGTGGGAAGGAGAAGGGTGG - Intronic
1153951423 18:10060850-10060872 CCCTGAGGGAAGGAATCAGGAGG + Intergenic
1154034478 18:10786170-10786192 GGCTGAGGCAGTGAGTAAGGGGG - Intronic
1155168786 18:23251660-23251682 GAAAGAGGGAAGGAGGGAGGAGG + Intronic
1155620145 18:27768964-27768986 GAGGGAGGGAGGGAGGAAGGTGG - Intergenic
1155833758 18:30551778-30551800 GTCTGAGGGAAGTTATAAGGAGG - Intergenic
1156388412 18:36627280-36627302 TGCTGAGGGTAGGAGTTAGGTGG + Intronic
1156723833 18:40103415-40103437 GAGAGAGGGAGGGAGGAAGGGGG - Intergenic
1156958021 18:42992070-42992092 CACGGAGGGAAGGAGTTAGGGGG - Intronic
1157119471 18:44895283-44895305 GAAGGAGGGAGGGAGGAAGGGGG + Intronic
1158103743 18:53861276-53861298 GAGAGAGGGAGGGAGGAAGGAGG + Intergenic
1158103749 18:53861291-53861313 GAAGGAGGGAGGGAGGAAGGAGG + Intergenic
1158103757 18:53861310-53861332 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1158103783 18:53861379-53861401 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1158103798 18:53861416-53861438 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1158103841 18:53861530-53861552 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1158259144 18:55588253-55588275 GACGGAGGGAAGGGGGGAGGGGG + Intronic
1159082004 18:63745603-63745625 GAAGGAAGGAAGGAGGAAGGAGG - Intergenic
1159356023 18:67338111-67338133 GAATGAGGGAGGGAGAGAGGAGG - Intergenic
1159865976 18:73705708-73705730 GAGTGAGAGAGGGAGAAAGGGGG - Intergenic
1160178644 18:76615891-76615913 GAGTCAGGGAAGGTGGAAGGGGG + Intergenic
1161139699 19:2640000-2640022 GAGGGAGGGAAGGAGGGAGGGGG + Intronic
1161194328 19:2977705-2977727 GACTGAGGCAAGGAAGAAGCTGG + Intronic
1161329107 19:3678022-3678044 GACGGAGGGATGGAGAATGGAGG + Intronic
1161329158 19:3678220-3678242 GACGGAGGGATGGAGGATGGAGG + Intronic
1161756592 19:6138501-6138523 GAGGGAGGGAAAGAGGAAGGAGG + Intronic
1162168129 19:8768299-8768321 GAGGGAGGGAGGGAGTGAGGGGG - Intergenic
1162169749 19:8779899-8779921 GAGGGAGGGAGGGAGTGAGGGGG - Intergenic
1162170817 19:8787358-8787380 GAGGGAGGGAGGGAGTGAGGAGG - Intergenic
1162583550 19:11545403-11545425 GGCTGAGAGAAGGAGAAAGGGGG + Intronic
1162805286 19:13135143-13135165 GACGGAGGGACGGGGTCAGGCGG - Intronic
1162922029 19:13908887-13908909 GAGAGAGGGAGGGAGGAAGGAGG - Intronic
1163109669 19:15151915-15151937 GACAGAAGGAAGAAGAAAGGAGG + Intergenic
1163129607 19:15264368-15264390 GCCTGAGGGAAGGGACAAGGTGG - Intronic
1163315667 19:16538937-16538959 GCCTGAGGGAGGGAGCATGGGGG - Intronic
1163462557 19:17447961-17447983 GAGGGAGGGAAGGAGGGAGGAGG + Intronic
1163779701 19:19239886-19239908 GAGGAAGGGAAGGAGAAAGGAGG - Intronic
1164581568 19:29438493-29438515 GAGGGAGGGAAGGAGAGAGGGGG + Intergenic
1164624945 19:29721079-29721101 GACTGAGGGAGGGAGCTGGGAGG - Intergenic
1164802357 19:31088178-31088200 GAGGGAGGGAAGGAAGAAGGAGG + Intergenic
1164863969 19:31588437-31588459 GAGAGAGGGAGGGAGTCAGGGGG + Intergenic
1165650395 19:37482871-37482893 GACAGAGAGAGGGAGAAAGGGGG - Intronic
1165963555 19:39555440-39555462 GTGTAGGGGAAGGAGTAAGGAGG - Intergenic
1166161910 19:40960475-40960497 GCCTGTGGGAAGGAGTAAGGCGG + Intergenic
1166232697 19:41434656-41434678 GAGAAAGGGAAGGAGAAAGGAGG + Intronic
1166719294 19:44988231-44988253 GAGGGAGGGGAGGAGGAAGGGGG - Intronic
1166844275 19:45717335-45717357 GCCGGAGGGAAGGAGCGAGGGGG - Intronic
1166880927 19:45929491-45929513 GACAGAGGGAGGGAGGATGGAGG + Intergenic
1166948085 19:46409250-46409272 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1167439900 19:49501924-49501946 GAGTGAGGGAGGGAGCCAGGTGG - Intergenic
1167634970 19:50649107-50649129 GACAGAGGGGAGGAGGCAGGGGG + Intronic
1167674708 19:50877153-50877175 GAGTCAGGGAAGGGGGAAGGAGG - Intronic
1168143947 19:54408658-54408680 GAGGGAGGGAGGGAGGAAGGGGG + Intergenic
1168499324 19:56880103-56880125 GACTGAGGGAAGTGGTGAGTGGG + Intergenic
925199262 2:1952944-1952966 GAGGGAGGGAGGGAGGAAGGAGG - Intronic
925597579 2:5571144-5571166 AACGGAGGGAAAGAGGAAGGAGG - Intergenic
925842623 2:8006739-8006761 GGCACAGGGAAGGAGAAAGGCGG - Intergenic
926244631 2:11113670-11113692 GAAGGAAGGAAGGAGGAAGGAGG - Intergenic
926947697 2:18206156-18206178 GAGGGAGGGAAGGAGGAAGGAGG - Intronic
927714255 2:25342044-25342066 GAGGGAGGGAAGGAGGAAGGCGG - Intronic
927959657 2:27233230-27233252 GGCTGAGGGAAGCAGTGAGCAGG + Intronic
928259883 2:29756993-29757015 GACAGAGGAAAGCAGAAAGGGGG + Intronic
928436409 2:31257334-31257356 GACAGAGGGATGTAGGAAGGAGG + Intronic
928869780 2:35962655-35962677 TTCTGAGGGATGGAGGAAGGGGG - Intergenic
929109305 2:38392983-38393005 GACTGAGGAAAAGTCTAAGGGGG - Intergenic
929857350 2:45648432-45648454 GGCTGAGGGAAGGATGAAGCTGG + Intergenic
930048745 2:47196923-47196945 AGCTGAGGGACTGAGTAAGGAGG - Intergenic
930741375 2:54836003-54836025 GACAGAGGCAAGGAGTCAAGAGG - Intronic
931909171 2:66876319-66876341 GAAGGAGGGATGGAGGAAGGAGG - Intergenic
932042800 2:68318771-68318793 GGCTGAAGGAGGGAGAAAGGAGG - Intronic
932457296 2:71857796-71857818 GACTGAGGGGCCGAGGAAGGGGG - Intergenic
932703638 2:74006982-74007004 GACAAAGGGAAGAAGAAAGGGGG - Intronic
932901242 2:75702880-75702902 GTAGGAGGGAAGGAGGAAGGAGG - Intronic
933347967 2:81114053-81114075 GACTCAGAGAAAGAGTAAGATGG - Intergenic
933593398 2:84258428-84258450 GACTGAGACAAGTTGTAAGGAGG + Intergenic
933701713 2:85259827-85259849 GAATGAGGAAAGGAAAAAGGAGG + Intronic
933891704 2:86778083-86778105 GTATGAGGGAGGGAGTAGGGAGG + Intergenic
934130009 2:88938869-88938891 GACTAAGAGAAGGAGCAATGAGG + Intergenic
934139447 2:89031568-89031590 GACTAAGAGAAGGACCAAGGAGG + Intergenic
934229792 2:90168975-90168997 GACTAAGAGAAGGAGCAAGGAGG - Intergenic
934499956 2:94850813-94850835 GAGTAAGGGAAGTACTAAGGTGG + Intergenic
934716449 2:96547372-96547394 GAGAGAGGGAAGGAGTAAGGAGG - Intronic
935136363 2:100306768-100306790 CACTGAGGGGAAGACTAAGGTGG - Intronic
935618949 2:105112264-105112286 GAAGGAGGGAAGGAGGAATGTGG + Intergenic
935714238 2:105926004-105926026 CACTGAGGGAAAGAGGAAGGAGG + Intergenic
936600515 2:113890310-113890332 GACTGTGGCACGGGGTAAGGGGG + Exonic
937367363 2:121273334-121273356 GCCTGAGGGAAGGGATGAGGAGG - Intronic
937569687 2:123341084-123341106 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
937690432 2:124749339-124749361 GAGAGAGGGAAGGAGGAGGGAGG - Intronic
937772398 2:125735492-125735514 GACTGAAGGAAGGAGAAATGAGG + Intergenic
938108707 2:128550300-128550322 GACAGAGGGAAGGAGGAGGAAGG - Intergenic
938138453 2:128777583-128777605 GACGGAGGGAGGGAGGGAGGAGG - Intergenic
938662197 2:133498549-133498571 GAGGGAGGGAAGGAGAAAAGAGG + Intronic
940723701 2:157309968-157309990 GAGGGAGGGAAGGAGAAAGGGGG + Intronic
940761695 2:157745628-157745650 GACTGGGGGCAGGAATATGGAGG - Intronic
941258150 2:163259406-163259428 CTCTGAGGGATGGAGGAAGGTGG + Intergenic
941999716 2:171633821-171633843 GGGAGAGGGAAGGAGGAAGGGGG - Intergenic
942478855 2:176359908-176359930 GAGTGAAGGTAGGAGTCAGGGGG - Intergenic
943167129 2:184343822-184343844 GACAGAGAGAAGGAGACAGGAGG - Intergenic
944333211 2:198497360-198497382 TTTTGAGGGAAGGAGTAATGGGG + Intronic
944905319 2:204256387-204256409 GATGGAGGGAAGGAGGTAGGAGG + Intergenic
944980161 2:205108498-205108520 GAGGGAGGGAGGGAGGAAGGTGG - Intronic
945064438 2:205936728-205936750 GCCGGAGGGAAAGAGGAAGGCGG + Intergenic
945208269 2:207355652-207355674 GAGAGAGGGAAGGAGAAAGTGGG - Intergenic
945391421 2:209269862-209269884 GACTGTGGGAAGGAGTGGGAAGG - Intergenic
946272734 2:218607865-218607887 GCCGGAGGGAAGCAGTAAGAAGG - Exonic
946686967 2:222280297-222280319 GAGGGAGGGAAGGAGGGAGGAGG + Intronic
946996261 2:225395506-225395528 GAGGGAGGGAAGGAGGGAGGGGG - Intergenic
947077716 2:226363918-226363940 GAAGGAGGGAAGGAGGAAGGAGG + Intergenic
947671102 2:231936015-231936037 GAGGGAGGGAAGGAGGGAGGAGG - Intergenic
948189439 2:236046488-236046510 GAATGATGGAAGAATTAAGGTGG + Intronic
948245654 2:236483037-236483059 GACTGGGGGAAGGAGAAAAGGGG - Intronic
948493431 2:238329171-238329193 GACAGAGAGAAAGAGTGAGGGGG + Exonic
948673265 2:239582021-239582043 GAGTGAGGGATGGGATAAGGCGG + Intronic
948673275 2:239582055-239582077 GAGTGAGGGATGGGATAAGGCGG + Intronic
948810059 2:240470212-240470234 GGCTTAGGGCAGGAGGAAGGTGG - Intergenic
948893018 2:240916262-240916284 GGCTGAGGGAAGGAGCAAGCAGG - Intergenic
948946374 2:241222349-241222371 CACTGCTGGAAGGAGTAAGATGG - Intronic
949035277 2:241813312-241813334 GGCTAAGGGAAGGAGGGAGGAGG - Intronic
1168989767 20:2084732-2084754 GGATGAGGGAAGGAAGAAGGTGG + Intergenic
1169135397 20:3194200-3194222 GGCTGAGGGAAGGAGTGCAGAGG - Intronic
1169342667 20:4808343-4808365 AACTGAGGCAAGGAGGAAAGAGG + Intronic
1169447229 20:5682667-5682689 GAGGGAGGGACGGAGTGAGGGGG - Intergenic
1169514795 20:6303921-6303943 GACTGGAGGAGGGAGTAAAGAGG + Intergenic
1169772978 20:9221518-9221540 GAGTGAGGCAAGGAGGAAGATGG - Intronic
1170217124 20:13903331-13903353 TACTGAGAGAAGGAGTGAGGAGG - Intronic
1170631750 20:18072334-18072356 GAGGGAGGGAAGGAGGGAGGAGG - Intergenic
1171018053 20:21559579-21559601 GGCTGAGGGAGGGAGAAACGGGG + Intergenic
1171086054 20:22239340-22239362 GAGGGAGGGAGGGAGGAAGGAGG - Intergenic
1171389192 20:24790250-24790272 GAGTGAGGGGAGGAGTGAGGGGG + Intergenic
1171961548 20:31498335-31498357 GACTGAGGGCTGGAGGAATGTGG - Intergenic
1172157551 20:32839195-32839217 GTCTGAGGTGAGGAGTTAGGAGG + Intronic
1172237930 20:33390456-33390478 GGCTGAGGGAAGGAGGAATGGGG + Intronic
1172474868 20:35228956-35228978 GACAGAGGGAAGGGGGAAGCAGG - Intronic
1172819519 20:37718879-37718901 GACTGAGGAAAGGAGTCTTGAGG + Intronic
1172988031 20:39008891-39008913 GGCTCAGGGAAGGAGGAAGCAGG - Intronic
1173438823 20:43057259-43057281 GAATGAAGGAAGGAGGAAGGGGG + Intronic
1173461138 20:43244253-43244275 GGCTGAGGGAGGGAGGAATGGGG + Intergenic
1173894309 20:46538702-46538724 GTATGAGGGAAGGAGCATGGTGG - Intergenic
1173961929 20:47080480-47080502 GAGGGAGGGAGGGAGTAAAGGGG + Intronic
1174387245 20:50194405-50194427 GACCTAGGGAAGGAGGGAGGTGG + Intergenic
1174473351 20:50777908-50777930 GAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1174518683 20:51113259-51113281 GAGGGAGGGAGGGAGGAAGGCGG - Intergenic
1175427213 20:58875891-58875913 GCATGGGGGAAGGAGCAAGGAGG + Intronic
1175579618 20:60088365-60088387 CACTGACGGAAGGAGGGAGGAGG + Intergenic
1175717138 20:61262763-61262785 GAGAGAGGGAAGGAGGAAGGAGG - Intronic
1175727120 20:61326109-61326131 GAGTGGAGGATGGAGTAAGGTGG + Intronic
1176384012 21:6127986-6128008 GAGGGAGGGAAGGAGAGAGGAGG + Intergenic
1176985427 21:15431002-15431024 GACTGGGGGAAGGGGGAAGTGGG - Intergenic
1177046901 21:16182555-16182577 GAGAGAGAGAAGGAGGAAGGAGG - Intergenic
1178363598 21:31970002-31970024 GTCTGAAGGAAGAAGGAAGGTGG - Intronic
1178541874 21:33458588-33458610 GGCTAGGGGAAGGAGTAATGGGG + Intronic
1179237899 21:39563559-39563581 GAGAGAAGGAAGGAGGAAGGTGG - Intronic
1179237911 21:39563606-39563628 GAGGGAGGGAACGAGGAAGGAGG - Intronic
1179244761 21:39623195-39623217 GAGGGAGGGAGGGAGGAAGGAGG - Intronic
1179739462 21:43410252-43410274 GAGGGAGGGAAGGAGAGAGGAGG - Intergenic
1180923819 22:19538277-19538299 GGGGGAGGGAAGGAGGAAGGAGG + Intergenic
1181142213 22:20814321-20814343 GACTGGGGGAAGGGGAAATGGGG + Intronic
1181528409 22:23502657-23502679 GATGGAGGGATGGAGTATGGAGG - Intergenic
1181793676 22:25287515-25287537 GACTGGGGGCAGCAGTAGGGAGG + Intergenic
1182022428 22:27091892-27091914 GACAGAGGGACGGTGTGAGGGGG + Intergenic
1182087731 22:27573244-27573266 GACTGTGAGGAGGAGGAAGGAGG + Intergenic
1182550723 22:31099480-31099502 AAATGAGGGAAGGAGTGATGAGG + Intronic
1183144401 22:35976342-35976364 GACTGAGGGAAGAATTAAGAGGG - Intronic
1183197489 22:36363453-36363475 GACAGAGGGAGGCAGGAAGGAGG + Intronic
1183283453 22:36947168-36947190 GAATCAGGGAAGAAGGAAGGGGG + Intergenic
1183321441 22:37167357-37167379 GACTCAGGGAGGGACTCAGGAGG - Intronic
1183640957 22:39092156-39092178 GACAGAGGGAAGGCATCAGGAGG - Intergenic
1183698770 22:39438096-39438118 GAGGGAGGGAAGGGGGAAGGAGG - Intergenic
1183971806 22:41483058-41483080 GGCTGAGGGCAGGACTGAGGTGG - Intronic
1184220741 22:43098212-43098234 GCCTGACGGAGGGAGCAAGGAGG - Intergenic
1184642451 22:45879629-45879651 GAGGGAGGGAGGGAGGAAGGGGG - Intergenic
1184891826 22:47384332-47384354 GACAGTGGGATGGAGGAAGGAGG + Intergenic
1185027249 22:48421979-48422001 GAGTGATGGAAGGAGTAAAGTGG + Intergenic
1185427660 22:50782419-50782441 CACTGAGGGAAGCAGTCTGGAGG - Intronic
950224363 3:11221745-11221767 GGCTGCGGGAAGGAGGAAAGGGG - Intronic
950315736 3:12000543-12000565 CACTGAGGGATGAAGAAAGGTGG + Intergenic
950722282 3:14891871-14891893 GAAGGAGGGAAGGAGGAAGGGGG - Intronic
951109562 3:18786002-18786024 GACTGAGTGAAGGACTGATGAGG + Intergenic
951502145 3:23400798-23400820 GAGGGAAGGAAGGAGAAAGGAGG - Intronic
951680202 3:25286604-25286626 GCCTGAATGGAGGAGTAAGGAGG - Intronic
951703883 3:25524633-25524655 GAAGGAGGGAGGGAGGAAGGAGG - Intronic
952089255 3:29864871-29864893 GAAGGAGGGAGGGAGGAAGGAGG + Intronic
952089299 3:29865026-29865048 GAAGGAGGGAGGGAGGAAGGAGG + Intronic
952398785 3:32944812-32944834 AACTGAGGAAAGCAATAAGGGGG - Intergenic
952457757 3:33489948-33489970 GACTGAGGGAAGTGGGAAAGAGG + Intergenic
952490458 3:33866472-33866494 GGCTGAGGGAAGGGGTATGAAGG - Exonic
952585778 3:34890196-34890218 GAGGGAGGGAGGGAGGAAGGAGG - Intergenic
953862012 3:46552579-46552601 GACTGAGGAAAGAAGGCAGGAGG - Intronic
954307093 3:49733738-49733760 GGCTGGGGGAAGGAGGAATGGGG + Intronic
954659664 3:52220344-52220366 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
954760789 3:52872112-52872134 GACTGAGGGATGGGACAAGGTGG - Intronic
955944308 3:64177569-64177591 GGCTGAGGGGAGGAGAAATGGGG - Intronic
956119407 3:65951041-65951063 GAGGGAGGGAGGGAGGAAGGTGG + Intronic
956428149 3:69157916-69157938 GAAGGAGGGAGGGAGAAAGGGGG + Intergenic
956914500 3:73857162-73857184 GAAGGAAGGAAGGAGAAAGGAGG - Intergenic
957305096 3:78447454-78447476 CACTTAGGGAAGGAGTAGGGAGG - Intergenic
958473917 3:94556246-94556268 GTAGGAGGGAAGGAGGAAGGGGG + Intergenic
959456111 3:106563717-106563739 GAGGGAGGGAAGGGGGAAGGAGG + Intergenic
960422369 3:117462877-117462899 GACTGATTGAAGGAGGAGGGTGG + Intergenic
960480235 3:118179127-118179149 GAGAGAGGGAAGGAGTGGGGTGG + Intergenic
960519451 3:118638244-118638266 GACTGTGACAAGGAGCAAGGTGG + Intergenic
960803730 3:121563197-121563219 AAGGGAGGGAAGGAGGAAGGAGG + Intergenic
961104894 3:124232532-124232554 GTCTCAGGGAAGGCATAAGGCGG - Intronic
961116018 3:124330716-124330738 GACTGAGGGATGGAGAGAGATGG + Intronic
961376331 3:126468615-126468637 GACTGGGGAAAGGGGAAAGGTGG - Intronic
961568122 3:127778343-127778365 GACTGAGGCTGGGAGTTAGGGGG - Intronic
962844170 3:139260630-139260652 GAGGGAGGGAGGGAGGAAGGGGG + Intronic
964417755 3:156466135-156466157 GACTGTGGGAGGGGGTGAGGAGG - Intronic
964640609 3:158906381-158906403 GACTGAGGGAATGCTGAAGGAGG - Intergenic
965061845 3:163793952-163793974 GAATGGGGGAGGGAGGAAGGAGG - Intergenic
965373871 3:167897574-167897596 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
965402714 3:168232176-168232198 GAAGGAAGGAAGGAGAAAGGAGG - Intergenic
965684272 3:171284860-171284882 AAAGCAGGGAAGGAGTAAGGGGG + Intronic
965743183 3:171898096-171898118 GACAGAGGGAAGGGACAAGGTGG + Intronic
965807232 3:172554088-172554110 GACAGAGGGAAAGAATGAGGAGG - Intergenic
966862264 3:184237059-184237081 GAATGAGGGTAGGAGCAAGCAGG - Intronic
966967334 3:185007176-185007198 GCCTGTGGGAAGGAGGAAGAGGG - Intronic
967734897 3:192941768-192941790 GACTGAGGGAGGGAGAAAAGAGG - Intergenic
967984857 3:195087081-195087103 GGCTGCGGGGAGCAGTAAGGGGG + Intronic
968003621 3:195224665-195224687 GACAGAGGGAAAGAGGCAGGAGG + Intronic
968441693 4:627665-627687 GAGTGAGGGGAGGAGGGAGGAGG - Intronic
969450261 4:7268924-7268946 GGCAGAGGGAAGGAGGGAGGTGG + Intronic
969609965 4:8222022-8222044 GAGAGAGGGGAGGAGAAAGGAGG - Intronic
969710729 4:8841473-8841495 GACTGAGGGAAGGTGAGGGGAGG - Intergenic
969822137 4:9728836-9728858 GCCTGAGGTCAGGAGAAAGGAGG - Intergenic
969983904 4:11187576-11187598 GACTGAGGGAAAGGTCAAGGCGG + Intergenic
970500619 4:16673036-16673058 GAAGGATGGAGGGAGTAAGGGGG - Intronic
971015963 4:22488945-22488967 GACTGAGGGAGGGAGAAATTGGG + Intronic
971073844 4:23125747-23125769 AACTGAGGGATGGAGCAGGGTGG + Intergenic
971103628 4:23497547-23497569 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
972032825 4:34483694-34483716 CACTGTGGAAAGTAGTAAGGAGG + Intergenic
972311869 4:37890372-37890394 GACGGGGAGAAGGGGTAAGGCGG + Intergenic
973543537 4:51957898-51957920 GACTTAATGAAGAAGTAAGGTGG + Intergenic
974020456 4:56688013-56688035 GAGGGAGGGAAGGAGGGAGGGGG + Intergenic
974166930 4:58215479-58215501 GGTAGAGGGAAGGAGCAAGGCGG + Intergenic
975030505 4:69608605-69608627 GAGTCAGGGAAGAAGGAAGGAGG + Intronic
975787463 4:77907512-77907534 GAGAGAGGGAAGGAGGAAGGGGG - Intronic
975960401 4:79897146-79897168 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
975966000 4:79973106-79973128 GAGGGAGGGAAAGAGGAAGGTGG + Intronic
976780464 4:88752720-88752742 GACTGAGAGGCGAAGTAAGGAGG + Intronic
977562329 4:98545063-98545085 GACAGTGGCAAGGAGTCAGGAGG + Intronic
977587847 4:98794662-98794684 GACTGAGGTTAGGAATGAGGTGG - Intergenic
977816009 4:101415124-101415146 GAAGGAGGGAGGGAGGAAGGAGG + Intronic
978014454 4:103724998-103725020 TACTGAGGGAAGGAGCAGAGAGG + Intergenic
979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG + Intergenic
980196523 4:129596109-129596131 GACTGAGGGAGGGGGGAGGGAGG + Intergenic
980524757 4:133975326-133975348 GACTGGGGGAAGGGGAAATGTGG + Intergenic
981092166 4:140743017-140743039 GATGGAGGGAGGGAGGAAGGAGG + Intronic
981498251 4:145417550-145417572 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
982457312 4:155625599-155625621 GGCAGAGGGCAGGAGTCAGGGGG + Intergenic
982797998 4:159668541-159668563 GAATCAGGGAAGGGGTAATGTGG + Intergenic
983076884 4:163337394-163337416 GACTGAGGGTATGAGGTAGGAGG - Intronic
983380601 4:166987373-166987395 GACTGAGGGAAGAGGCAAGGTGG - Intronic
983672491 4:170254420-170254442 AGGTGAGGGAGGGAGTAAGGAGG - Intergenic
984720770 4:182970758-182970780 GAAGGAAGGAAGGAGGAAGGAGG + Intergenic
984803289 4:183733746-183733768 GAAGGAAGGAAGGAGCAAGGAGG - Intergenic
985137667 4:186803556-186803578 TAATAAGGGAAGGAGTAAGGGGG - Intergenic
985158954 4:187024222-187024244 GACTGAAGGAGGCAGTAAGCAGG + Intergenic
985635766 5:1035026-1035048 GAGTGAGTGAATGAGTAAGTGGG + Intronic
985756644 5:1723431-1723453 GAGTGAGGAAAAGAGAAAGGAGG - Intergenic
985756662 5:1723512-1723534 GAAGGAGGGAAGGAGAAAGAGGG - Intergenic
985980055 5:3455310-3455332 GACTGAGGGAGAGAGTGAGGTGG - Intergenic
986026765 5:3858406-3858428 TGCTGAGGGAAGGGGTCAGGAGG + Intergenic
986042585 5:4008100-4008122 GAATGAGGCAAGGATGAAGGTGG + Intergenic
986240351 5:5954885-5954907 GAAGGAGGGAAGGAGAAGGGTGG - Intergenic
986240373 5:5954951-5954973 GAAGGAGGGAAGGAGAAGGGTGG - Intergenic
986454274 5:7899801-7899823 GACGGAGGGAAGAACTATGGTGG + Intronic
986500449 5:8393218-8393240 GAAGGAGGGAAGGAGAAGGGGGG + Intergenic
986796527 5:11218041-11218063 GAAGAAGGGAAGGAGGAAGGAGG - Intronic
987016545 5:13826253-13826275 GAGTGAGGGAAGTAGTGAAGTGG + Intronic
988394065 5:30674273-30674295 GAAGGAGGGAAGGGGGAAGGAGG + Intergenic
988861689 5:35287684-35287706 GACTGAGAGAAAGAGAAAGTGGG + Intergenic
989069629 5:37497183-37497205 GACGGAGGCAGGGAGTGAGGGGG - Intronic
989493606 5:42085449-42085471 GACTGAGGGAAGGGGAAAATGGG + Intergenic
989600741 5:43198372-43198394 GAGGGAGGGAGGGAGGAAGGGGG - Intronic
989773290 5:45170721-45170743 GGCTGAGGGAAGGGGTAAATGGG + Intergenic
989981895 5:50655479-50655501 GAGGGAGGGAAGAAGGAAGGAGG - Intergenic
990024364 5:51167438-51167460 GGCTGAGGGAGGGAGGAATGGGG - Intergenic
990822476 5:59858014-59858036 GAGGGAGGGAGGGAGTAGGGAGG + Intronic
991017999 5:61951723-61951745 GAAGGAGGGAGGGAGGAAGGAGG - Intergenic
991026794 5:62038221-62038243 GAGTGAGGGAGAGAGAAAGGAGG + Intergenic
991396458 5:66209425-66209447 GACATAGGGAGGGAGAAAGGAGG - Intergenic
991573253 5:68077378-68077400 GACTGAGGGAAGGGGGAAGAGGG + Intergenic
991602486 5:68367366-68367388 GTCTGAGGGTATGAGGAAGGGGG + Intergenic
992327773 5:75679764-75679786 GAGAGAGAGAAGGAATAAGGTGG + Intronic
992394505 5:76358548-76358570 AACGGAGGGAAGGAGTTCGGGGG - Intergenic
992758263 5:79929599-79929621 GACTGAAAGAAGCAGTAGGGAGG - Intergenic
993012638 5:82500854-82500876 GACAGAGAGAAGGAGGAAAGAGG - Intergenic
994679592 5:102869091-102869113 GTCTCAGAGAAGGAGCAAGGAGG - Intronic
995222661 5:109668429-109668451 GACTCAGGGAAGCAGTCAGAAGG - Intergenic
995996319 5:118304814-118304836 GAGAGATGGAAGGAGGAAGGAGG + Intergenic
996339202 5:122417656-122417678 GAAGGAAGGAAGGAGGAAGGAGG - Intronic
996921107 5:128768864-128768886 GAATTAGGGAAAGTGTAAGGTGG - Intronic
997391392 5:133520118-133520140 AAATGAGGGAAGGAGAAGGGAGG - Intronic
997444883 5:133933709-133933731 GAATGAAGGAAGGGGTGAGGAGG - Intergenic
997466264 5:134090099-134090121 GACTGATGGAAGGAGGAACTGGG - Intergenic
997536522 5:134626782-134626804 GACTGAAGGAAGGAAAAATGGGG + Intronic
997702995 5:135917900-135917922 GGCAGAGGGAAGGAGGGAGGAGG + Intergenic
997878867 5:137572287-137572309 GACTGAGTGCAGGAGTTGGGTGG - Intronic
998344017 5:141444922-141444944 GAAAGAGGGAAGGAGGGAGGAGG + Intronic
998355191 5:141529587-141529609 GATCCAGGTAAGGAGTAAGGTGG - Exonic
998389504 5:141778475-141778497 GAGTGAGGGAAGGAGGAGGCGGG + Intergenic
998435719 5:142107172-142107194 AACTGAGGGACAGAGTAAGGAGG + Intergenic
999246097 5:150155573-150155595 AACAGAGGGATGGAGGAAGGGGG + Exonic
1000020074 5:157311044-157311066 GGCGGAGGGAAGGAGGAAAGAGG + Intronic
1000115314 5:158148716-158148738 GAGGGAGGGAAGGAGAAAGAAGG - Intergenic
1000662985 5:163959182-163959204 GAAGGAAGGAAGGAGAAAGGAGG - Intergenic
1001041108 5:168336111-168336133 GGCTGAGGGCAGCAGTAAGTGGG - Intronic
1001193643 5:169652717-169652739 GACCAGGGGAAGGAGGAAGGAGG + Intronic
1001335111 5:170790425-170790447 ATCTGAGGGGAGGAGCAAGGAGG - Intronic
1001552644 5:172615269-172615291 GGCTGAGGGATGGAGGAAGTGGG + Intergenic
1001919378 5:175588529-175588551 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
1001972480 5:175967807-175967829 GTTTGAGGGAAGGGGAAAGGGGG - Intronic
1002025974 5:176396544-176396566 GGTTGAGGGAAGGGGTTAGGTGG + Intronic
1002064595 5:176645773-176645795 GAATGAGGGTAGGAGTCTGGTGG + Intronic
1002217851 5:177651954-177651976 GACTCAGGGAAGGGGTGAGAAGG - Intergenic
1002244959 5:177875973-177875995 GTTTGAGGGAAGGGGAAAGGGGG + Intergenic
1002254838 5:177951278-177951300 GACTGAGGGAAACACTGAGGGGG - Intergenic
1002365737 5:178709155-178709177 GACTGAGGGAAGGCAAAAGGGGG - Intergenic
1002485626 5:179534047-179534069 GGCTGAGGGGAGGAGGAAGTGGG + Intergenic
1002556925 5:180049228-180049250 GAGTGAGGGAAGGAGGCAGAGGG - Intronic
1002917659 6:1542025-1542047 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1002917708 6:1542169-1542191 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1003015360 6:2463247-2463269 GACCGAGTGAAGGAGAGAGGGGG - Intergenic
1003329240 6:5115962-5115984 GACTGAGGGGAGGAGGGAGAAGG + Intronic
1003979206 6:11374137-11374159 GAGTGAGCAAAGGAGTAAGGTGG - Intronic
1004350240 6:14884346-14884368 GCCTGGGGGTAGGAGGAAGGAGG + Intergenic
1004735919 6:18406371-18406393 GGCAGAGGGAAGCAGTATGGAGG + Intronic
1004885443 6:20047157-20047179 GAGTGAGTGAAGGAATAAGAAGG + Intergenic
1005166611 6:22929384-22929406 GGCTGGGGGAAGGAGGAAGTGGG - Intergenic
1005264777 6:24100457-24100479 GAGGGAGGAAAGGGGTAAGGGGG + Intergenic
1005319822 6:24642113-24642135 GAAGGAAGGAAGGAGTAGGGAGG + Intronic
1006334725 6:33414653-33414675 GATTGAGGAATGGCGTAAGGAGG + Intronic
1006555929 6:34866736-34866758 GACTGAGGGGAGGGGAAATGAGG - Intronic
1006827747 6:36948638-36948660 GAAGGAGGGAGGGAGGAAGGAGG - Intronic
1006827756 6:36948661-36948683 GAAGGAGGGAGGGAGGAAGGAGG - Intronic
1007020701 6:38517893-38517915 GCCTGAGGTGAGGATTAAGGTGG - Intronic
1007130300 6:39466230-39466252 GAGAGAAGGAAGGAGGAAGGGGG - Intronic
1007305895 6:40904291-40904313 CACAGAGGGAAGGGGTGAGGGGG - Intergenic
1007348792 6:41252978-41253000 GAGTGAGGGAAAGGGGAAGGTGG + Intergenic
1007400576 6:41600194-41600216 GCCTGGGGGAAGGAGAAAGGAGG + Exonic
1007514803 6:42402510-42402532 GACTGAAGGCAGGGGGAAGGGGG + Intronic
1007744500 6:44035004-44035026 CTCTGAGGGAAGGAGTTAGGAGG - Intergenic
1007791263 6:44310100-44310122 GAAAGAGGCAAGGAGTTAGGAGG + Intronic
1007849376 6:44789038-44789060 GCCTGAGGGGAGGAGGAAAGAGG - Intergenic
1008103431 6:47417223-47417245 GGCTGAGAGAAGGAGAAATGGGG - Intergenic
1008132276 6:47732731-47732753 AAGAGAGGGAGGGAGTAAGGAGG - Intergenic
1008134833 6:47762717-47762739 GGCTGAGGAAAGGAGGAAGTGGG - Intergenic
1008288387 6:49682535-49682557 GATGGAGGGAAGGAGGGAGGTGG - Intergenic
1008450370 6:51643841-51643863 GATTGGGGGGAGGACTAAGGGGG - Intronic
1008674716 6:53807270-53807292 GAATGAGGGAAGGAGGAGGGAGG - Intronic
1009313148 6:62182299-62182321 GACTGAGAGAAGGAGGAAACAGG + Intronic
1009535221 6:64873522-64873544 GGCTGGAGGAAGGAGCAAGGTGG + Intronic
1010131141 6:72494896-72494918 GAATGGGGGAAGGAGAAAGAGGG + Intergenic
1010796992 6:80128542-80128564 GACTGTGTGAAGCAGAAAGGAGG - Intronic
1011032109 6:82934568-82934590 AGTTGTGGGAAGGAGTAAGGAGG + Intronic
1012029832 6:94044882-94044904 GACTGAGGGTAGGGGAATGGAGG + Intergenic
1013523329 6:110952632-110952654 GAGGGAGGGAAGGAGAAGGGAGG - Intergenic
1013582602 6:111551099-111551121 GCTTGATGGAAGGGGTAAGGGGG + Intergenic
1014046215 6:116890875-116890897 GACTGGGGACAGGAATAAGGGGG + Intronic
1014688810 6:124535876-124535898 GCCTGAGGGAAGCAGTGAGGAGG - Intronic
1014856776 6:126411921-126411943 GAGGGAGGGAAGAAGAAAGGAGG - Intergenic
1014946162 6:127500675-127500697 GCCTGTGGGAAGGTGAAAGGTGG - Intronic
1016123988 6:140376507-140376529 AAGGGAGGGAAGGAGAAAGGGGG - Intergenic
1016337070 6:143018445-143018467 GAGAGAGGGAGGGAGGAAGGGGG + Intergenic
1016924912 6:149335022-149335044 GAGTGAGGGAAGGAGGGAGGCGG - Intronic
1017258911 6:152364660-152364682 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1018266261 6:162027868-162027890 GAGGGAGGGAAGAAGGAAGGTGG + Intronic
1018602804 6:165563248-165563270 GAGGGAGGGAGGGAGGAAGGAGG + Intronic
1018639006 6:165889899-165889921 GAGTGAGGGAGGGAGGAGGGAGG - Intronic
1018639020 6:165889943-165889965 GAGTGAGGGAGGGAGGAGGGAGG - Intronic
1018639041 6:165890017-165890039 GAGTGAGGGAGGGAGGAGGGAGG - Intronic
1019151739 6:170010975-170010997 GACAGAGGGAAGGAGGAGGGAGG + Intergenic
1019263715 7:99474-99496 TACAAAGGAAAGGAGTAAGGAGG + Intergenic
1019334879 7:478379-478401 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019334884 7:478397-478419 GGAGGAGGGAAGGAGAAAGGAGG + Intergenic
1019334978 7:478691-478713 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019334984 7:478709-478731 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019334990 7:478727-478749 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335000 7:478756-478778 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335020 7:478812-478834 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335026 7:478830-478852 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335036 7:478859-478881 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335052 7:478904-478926 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335058 7:478922-478944 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335078 7:478978-479000 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335084 7:478996-479018 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335094 7:479025-479047 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335114 7:479081-479103 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335120 7:479099-479121 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335130 7:479128-479150 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335146 7:479173-479195 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335152 7:479191-479213 GGAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019335167 7:479233-479255 GAAGGAGGGAAGGAGGAAGGAGG + Intergenic
1019338533 7:496326-496348 GAGGGAGGGAAGGAGTAAGTAGG + Intergenic
1019548011 7:1587657-1587679 GCCTGCGGGAAGGAGGAATGTGG - Intergenic
1019849945 7:3544908-3544930 GTCAGAGGGAAGCAGTATGGTGG + Intronic
1020173789 7:5866322-5866344 GACAGAAGGAAGGAGTGGGGGGG + Intergenic
1020738005 7:11976197-11976219 TACTATGGGAAGGAGGAAGGTGG - Intergenic
1020782532 7:12534956-12534978 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
1021329943 7:19324019-19324041 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1021407111 7:20284713-20284735 GAGTGAGGGAAGGAGAGAGAAGG - Intergenic
1021899143 7:25265957-25265979 GGCTGAGGGAAGTAGTGAAGGGG + Intergenic
1022090252 7:27103475-27103497 GAGAGAGGGAGGGAGAAAGGGGG - Intergenic
1022125971 7:27357889-27357911 AAATGAGGGAAGGGGTAAGTGGG - Intergenic
1022574804 7:31487303-31487325 GACAGGAGGAAGGAGGAAGGCGG - Intergenic
1023648094 7:42340338-42340360 GAGAAAGGCAAGGAGTAAGGCGG - Intergenic
1023809567 7:43901658-43901680 CACTGGGGGAAGGGGAAAGGGGG - Intronic
1024251417 7:47508495-47508517 GACTGAGATAAGGAGAAGGGCGG + Intronic
1025146991 7:56513911-56513933 GAAGGAAGGAAGGAGGAAGGGGG - Intergenic
1026202485 7:68226301-68226323 GACAGAGGGAAGGAGAAACAGGG + Intergenic
1026343342 7:69452883-69452905 GGCTGAGGGAGGGAGGAATGGGG + Intergenic
1026571912 7:71538792-71538814 GAGGAAGGGAAGGAGGAAGGAGG + Intronic
1026662821 7:72317169-72317191 GAGGGAGGGAAGGAGGCAGGAGG + Intronic
1026690309 7:72545177-72545199 GAGGGAGGGAGGGAGGAAGGGGG + Intergenic
1026871035 7:73852034-73852056 GAGGAAGGGAAGGAGGAAGGGGG - Intergenic
1027958742 7:84916794-84916816 GACTTCTGGAAGGATTAAGGTGG - Intergenic
1028075611 7:86510769-86510791 GACTAAGGTAAGGAGAAGGGAGG - Intergenic
1028165258 7:87531009-87531031 AACTAAGGGAAGGAGGAAAGTGG + Intronic
1029145002 7:98439582-98439604 AAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1029204881 7:98863638-98863660 GAAGGAGGGAAGGAAGAAGGAGG - Intronic
1029204885 7:98863653-98863675 GAAGGAGGGAAGGAGGAAGGAGG - Intronic
1029261532 7:99306055-99306077 GAGTGAGGGAAGGAGGAGTGGGG - Intergenic
1029561531 7:101306167-101306189 GCCTGGGGGAAGGAGGAAAGGGG + Intergenic
1029745285 7:102512854-102512876 GACTGAGGGAGGGGGTGAGAGGG + Intronic
1030037946 7:105424183-105424205 GAGGGAGGGAAGGAGGGAGGGGG - Intergenic
1030077193 7:105746901-105746923 GACTGCGGGCAGGAGTAGGAGGG + Intronic
1030268508 7:107645795-107645817 AAGTGAGGGATGGAGAAAGGGGG + Intergenic
1030971992 7:116069697-116069719 GACAGTGGGAAGGAGAAAAGTGG - Intronic
1031312697 7:120218467-120218489 GAGTAAGGGAAGGAAGAAGGTGG + Intergenic
1032505671 7:132432633-132432655 AACTGAGGGAATGGGTAAGAAGG + Intronic
1032591454 7:133195827-133195849 GAATGAGGGAGGGAGGGAGGAGG - Intergenic
1032735779 7:134691673-134691695 GACTGAGGGTAGGAAGACGGTGG - Intergenic
1032965518 7:137093105-137093127 GACAGAGGGAGGGATAAAGGGGG + Intergenic
1033263676 7:139865875-139865897 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1033310417 7:140257668-140257690 GACTCAGGGAAAGAGTAGGAAGG + Intergenic
1033330753 7:140415018-140415040 GAGTGAGGGTAGGAGAAAGATGG - Intronic
1033459583 7:141533232-141533254 GACTGAGGGAAGGTGGAGGGAGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035520745 8:273744-273766 GACTGAGGGGTGGGGGAAGGGGG + Intergenic
1036081888 8:5566234-5566256 GAATGAGGGAAGGATTACTGAGG + Intergenic
1037487163 8:19358515-19358537 GAAAGAGGGAAGGAGCAATGTGG + Intronic
1037806921 8:22063164-22063186 GACTGGGAGAAGGGGAAAGGAGG - Intronic
1038324769 8:26564507-26564529 GACCTAGGGAAGGAGAAAAGAGG + Intronic
1038331151 8:26610569-26610591 GATTGAGGGAAGGAGGGTGGAGG - Intronic
1038544358 8:28413656-28413678 AAGGGAGGGAAGGAGAAAGGAGG - Intronic
1038564212 8:28606357-28606379 GACTGAGGGCAGCAGGAACGGGG - Intronic
1039042820 8:33424346-33424368 GACACAGGGAAGAAGTAGGGAGG - Intronic
1039308411 8:36289540-36289562 GACTGAAGGTAGGGGAAAGGAGG + Intergenic
1040682221 8:49825991-49826013 GACTGATGGTAGGAATAAGCTGG - Intergenic
1040950803 8:52937712-52937734 TTCTGTGGGAAGGAGTAAGATGG - Intergenic
1041005907 8:53496825-53496847 GAGTGAGGAAAGGAGGGAGGAGG + Intergenic
1041582482 8:59477522-59477544 GATGGAGGGAAGGAGTGAGTTGG + Intergenic
1041719346 8:60962137-60962159 GAGGGAGGGAGGGAGTGAGGGGG - Intergenic
1041866564 8:62581725-62581747 GATGGAGGGAGGGAGGAAGGTGG - Intronic
1042364396 8:67919690-67919712 GACTGAGGGCTTAAGTAAGGTGG - Intergenic
1042417419 8:68538924-68538946 GGCTTAGGGTAGGAATAAGGTGG + Intronic
1042781101 8:72491896-72491918 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1042828645 8:73003454-73003476 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1042942121 8:74118374-74118396 GAGAGAGGGAAGAAGGAAGGAGG - Intergenic
1042972260 8:74422485-74422507 GAAGGAAGGAAGGAGAAAGGAGG - Intronic
1043402332 8:79896298-79896320 GACTGAGGGTAGGGGTGAGAGGG - Intergenic
1043540069 8:81251847-81251869 GGCTGTGGGAAGGAGAAATGGGG + Intergenic
1043944352 8:86232516-86232538 GTCTGAGGCATGGAGAAAGGTGG + Intronic
1044476063 8:92627885-92627907 GACTGAAGGAAGCTTTAAGGCGG + Intergenic
1044946471 8:97394397-97394419 GACAGAGAAAAGGAATAAGGTGG + Intergenic
1045245960 8:100441917-100441939 GAAGGAAGGAAGGAGTAGGGAGG - Intergenic
1045987404 8:108264571-108264593 GGCTGAGAGCAGGAGGAAGGTGG - Intronic
1046174241 8:110553891-110553913 GAATGAGGGAAGGTGTGAGGTGG - Intergenic
1046805642 8:118476330-118476352 GACAGAGGACAGGAGTAATGTGG + Intronic
1046970328 8:120215822-120215844 GACTGAGGGAAGAGGCAAGAGGG + Intronic
1047293463 8:123550513-123550535 GCCTGAGAGAAGCAGTAAGACGG - Intergenic
1047489590 8:125363585-125363607 GAGGGAAGGAAGGAGAAAGGAGG + Intronic
1047741756 8:127812188-127812210 GAGGGAGGGACGGAGGAAGGAGG + Intergenic
1048949487 8:139483525-139483547 GGCTGAGAGAAGGAGGAAGAAGG + Intergenic
1049210753 8:141385409-141385431 GAGAGAGGGAGGGAGAAAGGAGG - Intergenic
1049311835 8:141937568-141937590 TTCTGAGGGAAGGAGAGAGGAGG - Intergenic
1049370274 8:142261072-142261094 GAGAGAGGAAAGGAGGAAGGAGG + Intronic
1049370290 8:142261128-142261150 GAGGGAGGGAAGGAGGAAAGAGG + Intronic
1049478834 8:142810450-142810472 GAGGAAGGGAAGGAGGAAGGAGG - Intergenic
1050826305 9:9950827-9950849 GAATGAGGGAAGGAAAAATGAGG - Intronic
1050952598 9:11616935-11616957 GAAGGAGGGAGGGAGGAAGGAGG - Intergenic
1051057385 9:13004007-13004029 GACTGAGGGAAGGGTTACAGGGG - Intergenic
1051408511 9:16764897-16764919 GAAGGAGGGAAGGAGGGAGGAGG + Intronic
1051414642 9:16826198-16826220 GAGTGAAGTAAGGAGAAAGGGGG - Intronic
1051562976 9:18463541-18463563 GCCTGAGGGAAGGGGGAATGGGG - Intergenic
1051591499 9:18780299-18780321 AAATGAGGGAAGGAGGTAGGAGG - Intronic
1051660476 9:19421586-19421608 GGCTGAGGGAGGGAGAAATGAGG + Intronic
1053480879 9:38415403-38415425 GACAGAAGGCAGGAGGAAGGAGG + Intronic
1053493670 9:38532515-38532537 GACTGGGGGCAGGAGGGAGGTGG + Intergenic
1053657209 9:40229717-40229739 GAGTAAGGGAAGTACTAAGGTGG - Intronic
1054369329 9:64375994-64376016 GAGTAAGGGAAGTACTAAGGTGG - Intronic
1054527385 9:66146509-66146531 GAGTAAGGGAAGTACTAAGGTGG + Intronic
1054676961 9:67865750-67865772 GAGTAAGGGAAGTACTAAGGTGG - Intronic
1054795351 9:69296209-69296231 GACCAAGGGAAGGAGGCAGGAGG + Intergenic
1055572919 9:77634505-77634527 GACAGAGGGAGGGAGGGAGGAGG + Intronic
1056075848 9:83039384-83039406 GAATGAAGGAAGGAGGCAGGAGG + Intronic
1056522280 9:87412118-87412140 AACTGAGGGAAGGGGTTTGGGGG - Intergenic
1056935959 9:90914861-90914883 GACAGAGGGAAGGAAAAAGAAGG + Intergenic
1057437966 9:95059525-95059547 GAATGAGTGAGGGGGTAAGGGGG + Intronic
1057554108 9:96073909-96073931 GATAGAGGGAAGGAGAGAGGAGG - Intergenic
1058611809 9:106785730-106785752 GACTGAGGAAAGGAAGATGGGGG + Intergenic
1058719082 9:107747331-107747353 AAATGAGGGAATGAGAAAGGAGG + Intergenic
1059107834 9:111526566-111526588 GATTGATGGGAGAAGTAAGGAGG + Intronic
1059234464 9:112750624-112750646 GACGGAGGGAGGGAGGGAGGAGG - Intergenic
1059377767 9:113899295-113899317 GACTGGGGGAAGGGGAAATGGGG - Intronic
1059556920 9:115290725-115290747 GACTGAGAGTAGAAGTAATGTGG + Intronic
1059701054 9:116775675-116775697 GAGGGAGGGAGGGAGAAAGGAGG + Intronic
1060446183 9:123690146-123690168 GAGGGAGGGAGGGAGGAAGGAGG + Intronic
1060814311 9:126626710-126626732 GAGCGAGGGAAGGAGCAAGGAGG + Intronic
1061246025 9:129401681-129401703 GAGGGAGGGCAGGAGAAAGGGGG - Intergenic
1061255593 9:129453192-129453214 GATGGAGGGATGGAGTATGGAGG + Intergenic
1061281961 9:129602673-129602695 GAAGGAGGGAGGGAGGAAGGAGG + Intergenic
1061360246 9:130137071-130137093 CTCTGAGGGAAGGACTGAGGAGG - Exonic
1061838836 9:133346201-133346223 GACTGAGGGGAGAAGTGGGGGGG - Intronic
1062097945 9:134712359-134712381 GAAGGAGGGAAGAAGGAAGGAGG - Intronic
1062155903 9:135048431-135048453 AAATGAGGGGAGGAGTGAGGCGG - Intergenic
1062364409 9:136202137-136202159 GAGAGAGGGAGGGAGGAAGGAGG - Intronic
1062449209 9:136608451-136608473 GAAGGAGGGAAGGAGGAGGGAGG + Intergenic
1062452999 9:136623345-136623367 GAGAGAAGGAAGGAGAAAGGAGG - Intergenic
1203377011 Un_KI270442v1:384489-384511 GATGGAGGGAGGGAGAAAGGGGG - Intergenic
1185566597 X:1099693-1099715 GGCAGAGGGCAGGAGGAAGGTGG + Intergenic
1185627590 X:1493389-1493411 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1185700628 X:2228018-2228040 GAGGGAGGGAGGGAGGAAGGGGG + Intronic
1185884721 X:3772347-3772369 GGCTGAGGGAAGGGGGAAAGGGG - Intergenic
1186095082 X:6092001-6092023 GAGGGAGGGAGGGAGGAAGGGGG - Intronic
1186637023 X:11417322-11417344 GGATGAGGGCAGGAGTAGGGTGG + Intronic
1186730127 X:12401291-12401313 GAAAGAAGGAAGGAGAAAGGAGG - Intronic
1186981657 X:14963658-14963680 GACAGATGGAAGGAATGAGGGGG + Intergenic
1187132238 X:16514135-16514157 AAGGGAGGGAAGGAGGAAGGGGG + Intergenic
1187500232 X:19833206-19833228 GACTGTGGGAAAGAGGGAGGAGG - Intronic
1187500309 X:19833470-19833492 GACTGTGGGAAAGAGGGAGGAGG - Intronic
1187552951 X:20324194-20324216 GAAGGAGGGAGGGAGGAAGGGGG - Intergenic
1187658610 X:21511771-21511793 GAACAAGGGAAGGAGTAATGAGG - Intronic
1188173479 X:26958374-26958396 GAGGGAGGGAGGGAGGAAGGAGG + Intergenic
1188396331 X:29688033-29688055 GAATGAGGGTGGGAGTGAGGTGG + Intronic
1188586006 X:31776593-31776615 GAGGGAGGGAGGGAGGAAGGAGG + Intronic
1189319535 X:40079379-40079401 GACTGAGGGTGGGAGTTAAGGGG + Intronic
1189811591 X:44785767-44785789 GAATGAGGGAAGGAGGTAGTAGG + Intergenic
1190218724 X:48496984-48497006 GAGTGAGGTGAGGAGGAAGGGGG + Intergenic
1190357154 X:49616659-49616681 GAGAGAGAGAAGGAGGAAGGGGG - Intergenic
1190732958 X:53236592-53236614 GACAGAGGGAGGGAGGAGGGAGG - Intronic
1190931486 X:54952324-54952346 GGCTGAAGGAAGGAGACAGGGGG - Intronic
1191085870 X:56565903-56565925 GAGTGAGGGAAGTAGGAGGGAGG - Exonic
1191130297 X:57000774-57000796 GACTGAGGGAGGGAGGAATAGGG - Intergenic
1192203802 X:69083050-69083072 GACTCAGGGCGGGAGGAAGGAGG + Intergenic
1192354322 X:70386008-70386030 GAGGGAGGGATGGAGAAAGGGGG - Intronic
1192617978 X:72647691-72647713 GAGTGAGGGAAGAAGTAAGAAGG + Intronic
1192781015 X:74293721-74293743 GACCGAGGGGAGGGGAAAGGTGG - Intergenic
1192874123 X:75210601-75210623 GACGGAGGGCAAAAGTAAGGGGG + Intergenic
1195738667 X:108039617-108039639 GACTGTGAGAAGGACAAAGGTGG + Intergenic
1195990294 X:110675749-110675771 GAGGGAGGGAGGGAGTGAGGAGG + Intronic
1196463529 X:115951782-115951804 GACTGAAAGAAGGCATAAGGAGG - Intergenic
1196733292 X:118963001-118963023 GACTGACAGAGGGAGTAGGGTGG - Intergenic
1196738666 X:119004651-119004673 GACTGGGGGAGGCAGGAAGGAGG + Intronic
1197180785 X:123533813-123533835 GATTGAGGGAGGGACTAAGATGG - Intergenic
1197207357 X:123801550-123801572 GAAGGAGGGAGGGAGGAAGGAGG + Intergenic
1197207385 X:123801613-123801635 GAGGGAGGGAAGGAGGGAGGGGG + Intergenic
1197207403 X:123801668-123801690 GAAGGAGGGAGGGAGGAAGGAGG + Intergenic
1197501141 X:127243822-127243844 AACTGAGGCATGGAGTAGGGAGG + Intergenic
1197984933 X:132256996-132257018 GATGGAGGGAAGGAGTAATCTGG - Intergenic
1198206546 X:134471016-134471038 AAGGGAGGGAGGGAGTAAGGAGG - Intronic
1198327185 X:135585423-135585445 GACTGAGGGAAAAGGGAAGGAGG + Intergenic
1198585466 X:138115939-138115961 GACTGGGAAAAGGACTAAGGTGG + Intergenic
1199005543 X:142692286-142692308 GAAAGAGGGACGGAGGAAGGGGG + Intergenic
1199717802 X:150518636-150518658 GAATGAGGGAGGCAGTAAGGAGG + Intergenic
1200298504 X:154947456-154947478 TACTGTGGAAAAGAGTAAGGAGG + Intronic
1200381872 X:155845706-155845728 GTCTGAAAGAAGGAGAAAGGTGG + Intergenic
1200817463 Y:7548376-7548398 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1201058062 Y:10015528-10015550 GACAGAGGGAAGGAAGAAGGAGG + Intergenic
1201146041 Y:11066311-11066333 GAGGGAGGGAAGGAGCAAGGGGG + Intergenic
1201256348 Y:12112000-12112022 GAGGGAGGGAAGGGGGAAGGAGG - Intergenic
1201458934 Y:14201345-14201367 GAGGAAGAGAAGGAGTAAGGGGG + Intergenic
1201578225 Y:15483552-15483574 GACGGAGGGAAGGAACAAGGAGG - Intergenic
1201625747 Y:16012461-16012483 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
1201644203 Y:16209901-16209923 GACTGAGTGCAGTAGTAAAGTGG + Intergenic
1201658612 Y:16375420-16375442 GACTGAGTGCAGTAGTAAAGTGG - Intergenic
1201711775 Y:17000547-17000569 GACAGAGGGAAGGAGATAGAGGG - Intergenic
1201890902 Y:18942810-18942832 GACAGAGGGAGAGAGTGAGGAGG + Intergenic