ID: 1124786130

View in Genome Browser
Species Human (GRCh38)
Location 15:32682263-32682285
Sequence TGTGCACTAGAACCATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124786130_1124786134 14 Left 1124786130 15:32682263-32682285 CCTCCTCATGGTTCTAGTGCACA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1124786134 15:32682300-32682322 TATTATAGGAGAATGGAAAGAGG 0: 1
1: 0
2: 2
3: 22
4: 402
1124786130_1124786133 7 Left 1124786130 15:32682263-32682285 CCTCCTCATGGTTCTAGTGCACA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1124786133 15:32682293-32682315 TAGAGAATATTATAGGAGAATGG 0: 1
1: 0
2: 1
3: 34
4: 349
1124786130_1124786132 0 Left 1124786130 15:32682263-32682285 CCTCCTCATGGTTCTAGTGCACA 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1124786132 15:32682286-32682308 CTGAACTTAGAGAATATTATAGG 0: 1
1: 0
2: 1
3: 26
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124786130 Original CRISPR TGTGCACTAGAACCATGAGG AGG (reversed) Intronic
902954628 1:19917063-19917085 TGTGCACACGAATCATCAGGGGG + Intergenic
905453637 1:38073056-38073078 TGTGAACTGTAACCATGAGACGG - Intergenic
907743980 1:57194126-57194148 TGTGCATTAGAATCATCTGGAGG + Intronic
912529486 1:110310070-110310092 TGTGGACTATAAACATGTGGGGG - Intergenic
915913368 1:159927853-159927875 TGTGGACGAGAACTATGAGTGGG - Exonic
916731811 1:167573315-167573337 TGTGCACTGGAAGAATGGGGTGG + Intergenic
917210058 1:172622049-172622071 TGTGCACTGGGAGAATGAGGTGG + Intergenic
917267364 1:173235429-173235451 TGTGCACTGGGACAATGGGGTGG - Intergenic
921176148 1:212596222-212596244 TGTGCAGTAGAAAAGTGAGGTGG - Intronic
923245827 1:232131114-232131136 TGTTCACTAGAAGGATGGGGTGG + Intergenic
923789374 1:237098972-237098994 TGTGCACAAGTACAATGAGGAGG + Intronic
924652875 1:245946700-245946722 TGTACACTAGACCCATCAGAAGG + Intronic
1066745537 10:38602384-38602406 TGTGCCCTTGAACCATGAAGGGG - Intergenic
1067933436 10:50586807-50586829 TTTCCACTATAACCATGATGAGG + Intronic
1071675972 10:87656636-87656658 TATGCATTACAACCACGAGGGGG + Intergenic
1074283383 10:112074451-112074473 CCTGCAATAGAATCATGAGGAGG + Intergenic
1078057736 11:8020709-8020731 GGTGCACTGGAATCATGAGGTGG - Intronic
1083187486 11:61026173-61026195 CGTTCACCAGAACCATGAAGAGG - Intergenic
1096976266 12:55700743-55700765 TGTGCACTAGCTCAATGGGGTGG + Intronic
1101987975 12:109462175-109462197 TATGCCCTAAAACCATGAGAGGG - Intronic
1107560085 13:41550641-41550663 TGTCCACAAGAACCAGGAGATGG + Intergenic
1109831183 13:67791160-67791182 TGTGCACTGGAAGGATGGGGTGG - Intergenic
1113499669 13:110763588-110763610 TGTTCACAAGAGCCAAGAGGTGG - Intergenic
1113692776 13:112323536-112323558 TCTGCACTGCAGCCATGAGGTGG + Intergenic
1113813532 13:113156412-113156434 TGTGCAATAGTACTAGGAGGTGG + Intergenic
1114837662 14:26222743-26222765 TGTACACTAGTAAGATGAGGTGG + Intergenic
1117057906 14:51931899-51931921 TGTTCACTATAGCCAGGAGGTGG + Intronic
1121102953 14:91262817-91262839 TGTGTAATAGAACCAAGAGTGGG + Intergenic
1122052387 14:99068734-99068756 TGGGACCTTGAACCATGAGGAGG - Intergenic
1124091982 15:26614011-26614033 TGTGTACTGGAAGCATGATGAGG + Intronic
1124786130 15:32682263-32682285 TGTGCACTAGAACCATGAGGAGG - Intronic
1128534786 15:68482179-68482201 TGTGCACCAGGACCCTCAGGAGG - Intergenic
1129532621 15:76281000-76281022 GGATCACTTGAACCATGAGGTGG - Intronic
1129910823 15:79224814-79224836 TATTCACTATAACCAAGAGGTGG - Intergenic
1135807211 16:25553798-25553820 TGCGCACTAGAAGGATGGGGTGG - Intergenic
1139948555 16:70658071-70658093 TGTGCACCAGAGTCCTGAGGAGG - Intronic
1141766269 16:86061792-86061814 TCTGCATGGGAACCATGAGGCGG + Intergenic
1142622945 17:1176402-1176424 TGTACCCTAGAATAATGAGGAGG - Intronic
1143554766 17:7653148-7653170 TGTGCCCTAGGACCAGGAGGGGG + Intronic
1143905511 17:10205898-10205920 TGTGCACTAGGAGGATGAGGTGG + Intergenic
1146202598 17:30872858-30872880 ACTGCACTAGAAACCTGAGGAGG - Intronic
1147186151 17:38714067-38714089 TGTGTTCTAGAACCAGGAGATGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1152379697 17:79936026-79936048 TGAGCATTAGAACCAGGAGAGGG - Exonic
1152937146 17:83145759-83145781 TGTGTACAACATCCATGAGGTGG - Intergenic
1153505889 18:5797480-5797502 TGTGCACTAGAATCATTTGGAGG + Intergenic
1155073633 18:22337033-22337055 TGTGCTCAAGAACCCTGGGGTGG - Intergenic
1155370415 18:25094061-25094083 TTTGCACAAGAACCAAGAGATGG + Intronic
1155410015 18:25533488-25533510 TGTGCACTAGAAGCATGGGGTGG + Intergenic
1155645860 18:28076755-28076777 TGTTCAATTGAACAATGAGGAGG + Intronic
1159217474 18:65413603-65413625 CGTGGACCAGAACCAGGAGGTGG - Intergenic
1162804335 19:13129229-13129251 TGGGGACTAGAACCATTAGGTGG + Intronic
925537983 2:4936834-4936856 AATGCACTAGATCCATGATGGGG + Intergenic
928437679 2:31266269-31266291 GGCGCACTAGCACCATGAGCTGG - Exonic
934188662 2:89766378-89766400 AGTGCCCTTGAACCATGAAGGGG + Intergenic
935066417 2:99652326-99652348 TGTGCATTACATTCATGAGGGGG + Intronic
938560526 2:132468696-132468718 TGTGCAGTGGAAGCAGGAGGTGG + Intronic
941388043 2:164877486-164877508 TGAGAACCAGAACCATGATGAGG + Intergenic
942256277 2:174102251-174102273 TGTGCATTAGAATCATCTGGAGG - Intronic
1169390002 20:5182660-5182682 TCTCCACTAGGACCCTGAGGTGG + Intronic
1170618999 20:17978509-17978531 TGTGCTATAAAACCATTAGGTGG - Intronic
1171387289 20:24778929-24778951 TGTGCACCGGAACCATGGGAAGG + Intergenic
1173892544 20:46524198-46524220 TGTACACAAAAGCCATGAGGTGG - Intergenic
1174162706 20:48563214-48563236 TGTGCACTAGAAGCACCTGGGGG - Intergenic
1175309550 20:58002247-58002269 TTTGCACTCCAACCATGAGTGGG - Intergenic
1175915324 20:62423359-62423381 GGTGCACCAGAGCCATGGGGAGG - Intronic
1182420109 22:30244889-30244911 TCTGCACTGGAAACATGGGGCGG - Exonic
950162033 3:10767503-10767525 TGCCCACTGGAATCATGAGGAGG + Intergenic
951395404 3:22159476-22159498 TGTGTACTAGGACAATGATGAGG - Intronic
954921199 3:54192615-54192637 TGAGCACGAGAGCCATGAAGTGG + Intronic
957991861 3:87636380-87636402 TGTGCACTGGAAGAATGGGGTGG + Intergenic
959017641 3:101153659-101153681 TCTGCAATAGAACCATGACTGGG - Intergenic
961632138 3:128308799-128308821 TGTGCCCTAGAACCATGGATGGG + Intronic
963197275 3:142546237-142546259 TGAGAGCCAGAACCATGAGGGGG - Intronic
963769192 3:149371831-149371853 AGTGCACTCGGACCATGTGGAGG + Exonic
965925418 3:173972918-173972940 TGTGCAGGAGAATCATCAGGAGG - Intronic
968042271 3:195598769-195598791 ACTGCACTAGAAGCATGTGGAGG - Intergenic
969835166 4:9834528-9834550 TGTGCACTGGAACTATTAGATGG + Intronic
969898475 4:10326825-10326847 TGTGCTCTAGGATGATGAGGTGG + Intergenic
972678292 4:41281207-41281229 TGTGCACTATATCCAGTAGGTGG + Intergenic
973893066 4:55387173-55387195 TGCACACTAGAAGGATGAGGTGG + Intergenic
975425117 4:74216305-74216327 TGCCCACTAGAATCATCAGGAGG + Intronic
975874758 4:78823358-78823380 TGTGCATCAGAACCATTTGGGGG + Intronic
980739102 4:136928083-136928105 TGTGCTCTTGAAACATGAGATGG + Intergenic
983258284 4:165427018-165427040 TGTGCACTAGTATGATGGGGTGG - Intronic
990303390 5:54471765-54471787 TGTGCACTAGGAGGATGGGGTGG + Intergenic
991272429 5:64800215-64800237 TGTACAATATAATCATGAGGGGG - Intronic
996795770 5:127345126-127345148 TGTGCAATAGAAGCAGCAGGTGG + Intronic
999723745 5:154417970-154417992 TGAGAACTAGAACCATGATGAGG - Exonic
1000703342 5:164480123-164480145 TGTGCATTAGAATCACCAGGAGG - Intergenic
1000740835 5:164968565-164968587 TGTGCACTGGAAGGATGGGGTGG - Intergenic
1001092015 5:168748546-168748568 TGTGTTCTAGAACCAGGAAGAGG + Intronic
1006928162 6:37670452-37670474 AGTGCACTAGTACCATGAGAAGG - Intronic
1007308863 6:40929102-40929124 TGTGCACTAGAAAAATCTGGTGG - Intergenic
1008072616 6:47113072-47113094 TATGTCCTAGAACCATGAGCTGG + Intergenic
1010021894 6:71170159-71170181 TTTACACTAGAACTATAAGGAGG + Intergenic
1013700724 6:112766507-112766529 TGTGCATTAGAACTTTGAGCAGG - Intergenic
1016345597 6:143110660-143110682 AGTGCCCTTGAACCTTGAGGAGG + Intronic
1016996115 6:149963511-149963533 TCTCCACTAAAAGCATGAGGTGG - Intergenic
1017002474 6:150005698-150005720 TCTCCACTAAAAGCATGAGGAGG + Intergenic
1017773269 6:157659944-157659966 TTTGCTCTAGAACCATGCTGTGG + Intronic
1020955819 7:14739351-14739373 TGTGCACTGGAAAAATGGGGTGG + Intronic
1024140802 7:46461425-46461447 TGTGCACTAGAGGCATGGGGTGG - Intergenic
1026572479 7:71543524-71543546 TTTGCACGAGACCCATGAGGAGG - Intronic
1027526971 7:79281233-79281255 TGTGCATGAGAACCATGTGAAGG + Intronic
1028990739 7:97046346-97046368 AGAGCACTATAACCATGAGAAGG - Intergenic
1030056947 7:105591525-105591547 TATGCTCTAGAACCCTGCGGGGG - Intronic
1030533152 7:110735198-110735220 TGTGCACTAGGAATATGCGGTGG + Intronic
1030838648 7:114320052-114320074 TGTTCAGTAGAAGAATGAGGTGG + Intronic
1035468894 7:159097297-159097319 TGTGCACTTGAAGCATGGGGAGG + Intronic
1035494425 7:159310833-159310855 TGTGCACTGGAAAGATGGGGTGG - Intergenic
1040278889 8:46027760-46027782 TGTGCACTCGACAGATGAGGTGG + Intergenic
1040641416 8:49338543-49338565 TGTGTTTTAGAACCATGCGGAGG + Intergenic
1045893126 8:107181671-107181693 TGTGAACTAAAGGCATGAGGTGG - Intergenic
1046775909 8:118163498-118163520 TGTGCATTAGAACCACCTGGGGG + Intergenic
1051160374 9:14200881-14200903 TGTGCACTAGCAACATCAGGAGG - Intronic
1052251889 9:26408341-26408363 TGCACAATAGAACCATGACGAGG - Intergenic
1052633701 9:31072213-31072235 TGTCCACTACCAACATGAGGAGG - Intergenic
1053246969 9:36542560-36542582 TGTGCATTAGCACCACTAGGAGG - Intergenic
1053351018 9:37413277-37413299 TGGGCACTGGAACCATGAAAAGG + Intergenic
1059577542 9:115507103-115507125 TTTGCACAAGAAGGATGAGGTGG + Intergenic
1062061773 9:134500873-134500895 TCTGCCCTTGAACCACGAGGGGG - Intergenic
1062725974 9:138073792-138073814 TGCTCACAAGAACCCTGAGGTGG + Intronic
1187267850 X:17752278-17752300 TGGGCACCAGGACCACGAGGAGG + Intronic
1192973045 X:76253631-76253653 TGTTCACTTGACCCAGGAGGTGG - Intergenic
1196621946 X:117833828-117833850 TGTGCATTAGAAGCATATGGAGG - Intergenic
1197509803 X:127356507-127356529 TGTGCACTGGAAGGATGGGGTGG + Intergenic
1200353667 X:155525995-155526017 TGTGCAGTGAAACCATGTGGTGG + Intronic
1200393479 X:155968238-155968260 TGTGCACTAGAAAGATGGGGTGG - Intergenic
1200984376 Y:9290322-9290344 TGTGCTTCAAAACCATGAGGTGG + Intergenic
1202126067 Y:21569922-21569944 TGTGCTTCAAAACCATGAGGTGG - Intergenic