ID: 1124786836

View in Genome Browser
Species Human (GRCh38)
Location 15:32689558-32689580
Sequence CTGCTACTCACATGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124786833_1124786836 -4 Left 1124786833 15:32689539-32689561 CCTTTTAATGAACTTGAACCTGC 0: 1
1: 1
2: 2
3: 11
4: 135
Right 1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 164
1124786832_1124786836 -3 Left 1124786832 15:32689538-32689560 CCCTTTTAATGAACTTGAACCTG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 164
1124786830_1124786836 24 Left 1124786830 15:32689511-32689533 CCAAAATCTTGATGGCACTATGG 0: 1
1: 0
2: 1
3: 23
4: 301
Right 1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124786836 Original CRISPR CTGCTACTCACATGGAAAAC AGG Intronic
904275872 1:29384043-29384065 CTGGTACCAACATGGAAATCTGG + Intergenic
905829141 1:41050262-41050284 CCGCTACTCAAATGGGAAGCTGG - Intronic
907425060 1:54374307-54374329 CCGCTACTCACAAGGAGCACAGG + Intronic
914923637 1:151864901-151864923 CAGCTCCTCACATGGAAAACAGG + Intergenic
917739665 1:177950356-177950378 CTCAGGCTCACATGGAAAACTGG + Intronic
918564600 1:185913615-185913637 TTGCTACTAACATGGAAGAATGG - Intronic
922207729 1:223463054-223463076 CTGCTACTCTCATGGTACAAAGG + Intergenic
924504958 1:244673481-244673503 CTTTTAGTCACAAGGAAAACAGG - Intronic
1064999625 10:21326892-21326914 CTGCTAATTAAATGGACAACTGG + Intergenic
1067897458 10:50199727-50199749 CTGATCCTCACATGGGAGACTGG - Intronic
1067951515 10:50742312-50742334 CTGATCCTCACATGGGAGACTGG + Intronic
1069880929 10:71592714-71592736 ATGCTACTTACATGGCAAAGGGG - Intronic
1074727500 10:116326878-116326900 CTACTATTCACAGGCAAAACAGG - Intronic
1076182122 10:128418178-128418200 CTGCTTCTCTGATGGAAACCAGG + Intergenic
1077364741 11:2157013-2157035 CTGCTCCTGGCATGGATAACTGG - Intronic
1077641513 11:3885943-3885965 CTCAAACTCACATCGAAAACTGG - Intronic
1078300184 11:10121567-10121589 CTGCTAGTCATATGTAAAATTGG - Intronic
1081729678 11:45361512-45361534 TTGCTACTCCCGTGGAAGACTGG + Intergenic
1085792739 11:79509954-79509976 CTTGTTCTCACATGGAAAAGGGG - Intergenic
1085796039 11:79540861-79540883 CTGCTGCTCACCTGGAAGACAGG - Intergenic
1086192785 11:84099127-84099149 TTACTACTCAAATGGAAATCAGG + Intronic
1086338317 11:85822196-85822218 CTGAGACTCACAGAGAAAACTGG - Intergenic
1086592236 11:88529042-88529064 CTGCTACTTATTTGCAAAACGGG - Intronic
1086739932 11:90354212-90354234 CAATTACTCACATGGAAAAAGGG + Intergenic
1089941448 11:122422288-122422310 TTGCTACTCCCATGGAGACCTGG + Intergenic
1092834415 12:12474043-12474065 CTGTCATTCACATGGAACACCGG - Intergenic
1093879055 12:24382914-24382936 CTGCTTGGCACATGCAAAACTGG - Intergenic
1095710824 12:45286116-45286138 CTGCTGCTCAGAGGTAAAACAGG - Intronic
1096172468 12:49483507-49483529 CTGCTACTCAAATGAAAAATCGG - Intronic
1098002083 12:65955536-65955558 CTTCTACCCAAAGGGAAAACAGG + Intronic
1099317066 12:81097385-81097407 CTACAACTCACATGTCAAACTGG - Intronic
1100489509 12:95065555-95065577 ATAATAATCACATGGAAAACAGG + Intronic
1103513899 12:121494346-121494368 CTGGTGGTCACTTGGAAAACTGG - Intronic
1106855124 13:33842840-33842862 CTGATTCACACATGGAAACCAGG - Intronic
1107015654 13:35706275-35706297 CTCCTCCTCACATGGAAACATGG - Intergenic
1111737368 13:92159475-92159497 ATGCTTCTCAAATGGACAACGGG - Intronic
1112143675 13:96674216-96674238 CTGCTCCCCCCATGTAAAACAGG + Intronic
1113475386 13:110576900-110576922 CTGTTAGTCATAGGGAAAACCGG - Intergenic
1116334552 14:43640320-43640342 CTCCTACTCCTATGGAAAAGGGG + Intergenic
1116913384 14:50495462-50495484 CTGTTACTGACATTGCAAACTGG + Intronic
1117025360 14:51614288-51614310 ATTCTAGTCACATGGAATACAGG + Intronic
1117431656 14:55671263-55671285 ATGCTACACACATGGGAAAGAGG - Intronic
1122899273 14:104775506-104775528 CTGCGCCCTACATGGAAAACCGG + Intronic
1202836695 14_GL000009v2_random:82963-82985 CAGCTACTCACCTGGAAACAAGG - Intergenic
1123580576 15:21711787-21711809 CTGTTTCTCACATGGAATAATGG - Intergenic
1123617224 15:22154410-22154432 CTGTTTCTCACATGGAATAATGG - Intergenic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1127432358 15:58923054-58923076 ATGCTGGACACATGGAAAACAGG + Intronic
1132269027 15:100506519-100506541 GTGCCACTGCCATGGAAAACAGG + Intronic
1202989446 15_KI270727v1_random:446032-446054 CTGTTTCTCACATGGAATAATGG - Intergenic
1132642214 16:983080-983102 CTGCTCCTCACCTGGAAGAAGGG + Intronic
1133366782 16:5216480-5216502 CTGCTTCTCTCAAGGAAATCAGG - Intergenic
1135864504 16:26088661-26088683 CAGCTTCTCACATGTACAACAGG - Intronic
1137586778 16:49668550-49668572 CTGCCAATCAAGTGGAAAACAGG - Intronic
1138123781 16:54422323-54422345 TTGGTACTGACATGCAAAACAGG + Intergenic
1139377655 16:66510363-66510385 CTGCTAATTAGCTGGAAAACTGG - Exonic
1141333192 16:83131136-83131158 CTGCTACTCACTTAGATAGCAGG + Intronic
1143536133 17:7541116-7541138 CTGGGTCTCACATGGAAAAATGG - Intergenic
1143702935 17:8675004-8675026 CTGCTACTCAGATGGAAATGGGG - Intergenic
1144384958 17:14740831-14740853 CTGCTTTTCAAATGGAGAACAGG - Intergenic
1148170219 17:45513351-45513373 AAGCTACTCACCTGGAATACTGG - Intergenic
1148170696 17:45517344-45517366 AAGCTACTCACCTGGAATACTGG - Intergenic
1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG + Intronic
1148301203 17:46550336-46550358 CAGCTACTCACCTGGAATACTGG + Intronic
1148365329 17:47051208-47051230 AAGCTACTCACCTGGAATACTGG + Intergenic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149514145 17:57267294-57267316 CTGCTACTGACTTGGAACATAGG - Intronic
1150401310 17:64858927-64858949 AAGCTACTCACCTGGAATACTGG - Intronic
1153094575 18:1385629-1385651 CTACTAAGCAAATGGAAAACAGG + Intergenic
1155369142 18:25079540-25079562 CTGCTACTGAATTGTAAAACTGG - Intronic
1158620563 18:59029121-59029143 CTAATACACACATGGAAAAGGGG - Intergenic
1160065737 18:75572786-75572808 CTTCTACTCACAGGGAAGCCAGG - Intergenic
1167934059 19:52892058-52892080 CAGCTACTGACCTTGAAAACAGG + Intronic
926620684 2:15044250-15044272 CTGCTACTTACCTGCAAATCAGG - Intergenic
926889248 2:17625319-17625341 CTGCTACTGGCATGGTAACCAGG - Intronic
927489879 2:23514234-23514256 CAGCTCCTCAGATGAAAAACAGG - Intronic
929799514 2:45087605-45087627 TTAATACACACATGGAAAACTGG - Intergenic
930806407 2:55494986-55495008 CAGCTACTCACTTGGGAAGCTGG + Intergenic
933569227 2:83989690-83989712 TTGCTAATCAAATGGACAACTGG - Intergenic
933598061 2:84302571-84302593 CTGCTCCTCCCATGAAAAAGTGG - Intergenic
935851365 2:107223551-107223573 CTGATACTCAGATTGAAACCAGG + Intergenic
937004905 2:118502322-118502344 TTGCCACTCAGATGGAAATCAGG - Intergenic
938433666 2:131268475-131268497 CTGCTACTTACCTGGAAATAAGG - Intronic
938661537 2:133491950-133491972 TTACTACTCATATGGTAAACAGG + Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
945939709 2:215935960-215935982 ATGTTAATAACATGGAAAACTGG + Intergenic
948023071 2:234753241-234753263 CTGCTACACAGATGGAAAGAGGG + Intergenic
949019514 2:241733554-241733576 CTGGTAGTCACACAGAAAACCGG - Intergenic
1169704277 20:8484887-8484909 CTGGTACCCACATGCACAACTGG - Intronic
1172435883 20:34928680-34928702 CTGGTCCTCAGATGGAAAGCTGG + Exonic
1179778439 21:43683362-43683384 CTGCTACCCACCTGGAGAAGGGG - Exonic
1181648865 22:24247972-24247994 CTGCTGCTCACAGGGGAAGCCGG + Intergenic
1181702486 22:24628917-24628939 CTGCTGCTCACAGGGGAAGCCGG - Exonic
950845722 3:16014268-16014290 ATGCTACTCATCTGTAAAACTGG + Intergenic
951765819 3:26197504-26197526 CTGATACTTACTTGAAAAACTGG + Intergenic
953401323 3:42621505-42621527 TGCCTACTCACATGAAAAACTGG - Exonic
955064314 3:55521508-55521530 GAGCTACTCACCTGGAAAAGTGG - Intronic
955691558 3:61595684-61595706 CTAATATTCACATGTAAAACTGG + Intronic
957147053 3:76437811-76437833 CTGCTAATGACATGGAAAAAGGG - Intronic
960992503 3:123321128-123321150 CTCTTACTCAGATGGAAATCGGG + Intronic
961645357 3:128389896-128389918 CTGCTACCAACATGGAAAGAAGG - Intronic
962001487 3:131303161-131303183 CTGCCACAAAAATGGAAAACAGG - Intronic
962445338 3:135458691-135458713 TTGGTGCTCTCATGGAAAACTGG + Intergenic
966853649 3:184179447-184179469 CAGCTGCTGAGATGGAAAACTGG - Intronic
969419544 4:7084153-7084175 CTGCTGCTAACGTGCAAAACGGG - Intergenic
969665152 4:8553179-8553201 CTGCTTCCCACATGTAAAAGGGG + Intergenic
971849964 4:31972286-31972308 CAGCTACTCATCTAGAAAACTGG - Intergenic
975222232 4:71826016-71826038 CTGTTAGTAACATGGAAAATAGG - Intergenic
978672305 4:111264401-111264423 ATGCAACTCACATGAAAAAGTGG - Intergenic
984278503 4:177638808-177638830 CTCACACTCACATAGAAAACTGG - Intergenic
986098192 5:4580785-4580807 CTGTTACCCTCATGGAACACCGG + Intergenic
986305202 5:6509257-6509279 CTGGTTCTCACAGGGAGAACAGG - Intergenic
986722593 5:10570438-10570460 CTGCCCCTGCCATGGAAAACAGG - Intronic
986896918 5:12382535-12382557 CTACTAAGCAAATGGAAAACAGG - Intergenic
986901273 5:12437061-12437083 TTGTTCCTCACAGGGAAAACAGG + Intergenic
987720594 5:21627892-21627914 CTGTTACTCACTTGGAAAGGCGG - Intergenic
990297969 5:54421949-54421971 CACATACTGACATGGAAAACTGG + Intergenic
992134958 5:73735368-73735390 CTGCTACTAAATTGTAAAACAGG - Intronic
994617846 5:102128409-102128431 CAGCTACTTACATATAAAACTGG + Intergenic
996322333 5:122232810-122232832 CTGGTACTAACATGGAAAGGAGG - Intergenic
996717322 5:126598408-126598430 CAACTGCTCACATTGAAAACAGG + Intergenic
997005431 5:129811249-129811271 CTGCTCCTCAAATGGGAATCAGG + Intergenic
999439181 5:151588293-151588315 CTGCCACTTACATAAAAAACAGG + Intergenic
1003513619 6:6801509-6801531 CTGCTTTTTAAATGGAAAACCGG - Intergenic
1004200803 6:13546189-13546211 CTGCTTCTGACATGGAAAACAGG - Intergenic
1005255582 6:23999401-23999423 CTGCCACTAACATGGAAACAAGG + Intergenic
1008313461 6:50007856-50007878 CTGATGTTCATATGGAAAACGGG - Intergenic
1010707937 6:79136357-79136379 CTGCCAAGCAAATGGAAAACAGG + Intergenic
1011951806 6:92976101-92976123 CAGCTACTTACATTGTAAACTGG + Intergenic
1015025933 6:128532430-128532452 CTGCTACTGAAATGTGAAACTGG + Intergenic
1015156036 6:130097180-130097202 CTACTAATGAAATGGAAAACAGG - Intronic
1015737581 6:136417193-136417215 CTGATTCTCACAAGGAAAAAGGG + Intronic
1021843807 7:24744861-24744883 CTGGCACTCAGATGGAAAGCCGG + Intronic
1022818810 7:33938667-33938689 CCCCTACTCACATGGAAATGTGG - Intronic
1026518215 7:71091267-71091289 ATGCTGCTAACATGGAATACAGG + Intergenic
1029269239 7:99366887-99366909 CTGTTGCTCACATGCAAGACGGG - Intronic
1029923302 7:104289157-104289179 CAGCTTCTGACATGGATAACAGG - Intergenic
1030456608 7:109782453-109782475 CTGCTGAGCACATGGAAATCTGG + Intergenic
1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG + Intronic
1034311289 7:150091108-150091130 CTGCTAATGAGATGGAAAGCAGG - Intergenic
1034374522 7:150630552-150630574 CTGCTGCTCCCAGGGAACACAGG - Intronic
1034446823 7:151117956-151117978 CTGCTAGTCACAGGGACAGCAGG - Intronic
1034698448 7:153075641-153075663 CTGCCACACTCAGGGAAAACTGG - Intergenic
1034795567 7:154009535-154009557 CTGCTAATGAGATGGAAAGCAGG + Intronic
1036014048 8:4760991-4761013 CTGCTACTCACAATGATAAAGGG - Intronic
1036382496 8:8246231-8246253 CAGCTACTCACATGGGAGTCAGG - Intergenic
1036979039 8:13448218-13448240 CTTACACTCACATGGAAAAAAGG + Intronic
1037449484 8:19002286-19002308 CAGCAACTCACAAGGAAGACGGG - Intronic
1037738719 8:21588044-21588066 CTGCTTCTCACATAAAACACTGG + Intergenic
1038370897 8:26989308-26989330 CTGCTTCTCATATGTAAAAGGGG + Intergenic
1042590353 8:70392299-70392321 GTGCGACTCAGATGGAAAAGTGG - Intronic
1043564959 8:81537739-81537761 CTGCTACTCAAATGCACACCTGG + Intergenic
1045287551 8:100805081-100805103 CTGCTTCTCACCTGCAAAATGGG + Intergenic
1047533771 8:125700567-125700589 CTGATACTCATATGGAAGACAGG + Intergenic
1047975181 8:130122821-130122843 CTGCTTCCCACATGAGAAACAGG + Intronic
1049282899 8:141759543-141759565 CTGCCACTTACAGGGCAAACGGG + Intergenic
1049440851 8:142608998-142609020 CTACTTCTCACATGAAAAGCTGG - Intergenic
1050701486 9:8344601-8344623 CTGCTATTCATATGGAAGATAGG + Intronic
1052138200 9:24942137-24942159 CTCCTACTCAAAGGGATAACAGG - Intergenic
1054823567 9:69548149-69548171 CTGCTGCTGACTTGGAAGACGGG + Intronic
1056551353 9:87655688-87655710 CTCCTTCTCATATGGAAATCAGG + Intronic
1057009030 9:91585161-91585183 CTGCTTCTCACATGTAACATGGG + Intronic
1058903245 9:109460053-109460075 CTGCTACACAGATGAATAACAGG + Intronic
1058999524 9:110334205-110334227 GTTGTACTCACATGGAAAACAGG + Exonic
1060965404 9:127709752-127709774 CTGTTTCTCACCTGGGAAACAGG + Intronic
1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG + Exonic
1061745826 9:132739759-132739781 CTTCTACTAACATGGAAGTCAGG + Intronic
1061958725 9:133977227-133977249 CTGCTCCTCAAATGGACACCAGG - Intronic
1062088125 9:134659032-134659054 CTGCTTCTCACCTGTAAAATGGG - Intronic
1186549944 X:10493102-10493124 ATGTTACTCACATGGCAAAAGGG + Intronic
1186636830 X:11415228-11415250 CTGCTACACACAAGGAAACAGGG + Intronic
1187737269 X:22317489-22317511 CTGCTCCTCATATGTAAAATGGG - Intergenic
1191721317 X:64230840-64230862 CTGCCACTCAAATGGGAGACAGG + Intergenic
1192487322 X:71539872-71539894 CTGCTACACACATAGGCAACTGG - Intronic
1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG + Intergenic