ID: 1124788261 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:32701885-32701907 |
Sequence | CTCAAGATATACTCCTGGCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124788261_1124788263 | 11 | Left | 1124788261 | 15:32701885-32701907 | CCTAGCCAGGAGTATATCTTGAG | No data | ||
Right | 1124788263 | 15:32701919-32701941 | CTTTGAAGCCTCCTGAAGCCTGG | No data | ||||
1124788261_1124788264 | 12 | Left | 1124788261 | 15:32701885-32701907 | CCTAGCCAGGAGTATATCTTGAG | No data | ||
Right | 1124788264 | 15:32701920-32701942 | TTTGAAGCCTCCTGAAGCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124788261 | Original CRISPR | CTCAAGATATACTCCTGGCT AGG (reversed) | Intergenic | ||