ID: 1124788261

View in Genome Browser
Species Human (GRCh38)
Location 15:32701885-32701907
Sequence CTCAAGATATACTCCTGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124788261_1124788263 11 Left 1124788261 15:32701885-32701907 CCTAGCCAGGAGTATATCTTGAG No data
Right 1124788263 15:32701919-32701941 CTTTGAAGCCTCCTGAAGCCTGG No data
1124788261_1124788264 12 Left 1124788261 15:32701885-32701907 CCTAGCCAGGAGTATATCTTGAG No data
Right 1124788264 15:32701920-32701942 TTTGAAGCCTCCTGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124788261 Original CRISPR CTCAAGATATACTCCTGGCT AGG (reversed) Intergenic