ID: 1124788262

View in Genome Browser
Species Human (GRCh38)
Location 15:32701890-32701912
Sequence ACTTTCTCAAGATATACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124788262_1124788268 30 Left 1124788262 15:32701890-32701912 CCAGGAGTATATCTTGAGAAAGT No data
Right 1124788268 15:32701943-32701965 TTTTACCAACAGCCCAGTCCTGG No data
1124788262_1124788264 7 Left 1124788262 15:32701890-32701912 CCAGGAGTATATCTTGAGAAAGT No data
Right 1124788264 15:32701920-32701942 TTTGAAGCCTCCTGAAGCCTGGG No data
1124788262_1124788263 6 Left 1124788262 15:32701890-32701912 CCAGGAGTATATCTTGAGAAAGT No data
Right 1124788263 15:32701919-32701941 CTTTGAAGCCTCCTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124788262 Original CRISPR ACTTTCTCAAGATATACTCC TGG (reversed) Intergenic