ID: 1124788268

View in Genome Browser
Species Human (GRCh38)
Location 15:32701943-32701965
Sequence TTTTACCAACAGCCCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124788262_1124788268 30 Left 1124788262 15:32701890-32701912 CCAGGAGTATATCTTGAGAAAGT No data
Right 1124788268 15:32701943-32701965 TTTTACCAACAGCCCAGTCCTGG No data
1124788265_1124788268 -7 Left 1124788265 15:32701927-32701949 CCTCCTGAAGCCTGGGTTTTACC No data
Right 1124788268 15:32701943-32701965 TTTTACCAACAGCCCAGTCCTGG No data
1124788266_1124788268 -10 Left 1124788266 15:32701930-32701952 CCTGAAGCCTGGGTTTTACCAAC No data
Right 1124788268 15:32701943-32701965 TTTTACCAACAGCCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124788268 Original CRISPR TTTTACCAACAGCCCAGTCC TGG Intergenic