ID: 1124803061

View in Genome Browser
Species Human (GRCh38)
Location 15:32853819-32853841
Sequence GGCCAGGCCCAGAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 1, 2: 9, 3: 95, 4: 671}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124803049_1124803061 17 Left 1124803049 15:32853779-32853801 CCTCCTTTGGTTACGTAGCCCCA 0: 1
1: 0
2: 2
3: 5
4: 43
Right 1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 9
3: 95
4: 671
1124803055_1124803061 -3 Left 1124803055 15:32853799-32853821 CCACTTGAGAGCCAAACAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 9
3: 95
4: 671
1124803051_1124803061 -1 Left 1124803051 15:32853797-32853819 CCCCACTTGAGAGCCAAACAAGG 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 9
3: 95
4: 671
1124803050_1124803061 14 Left 1124803050 15:32853782-32853804 CCTTTGGTTACGTAGCCCCACTT 0: 1
1: 0
2: 1
3: 2
4: 42
Right 1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 9
3: 95
4: 671
1124803053_1124803061 -2 Left 1124803053 15:32853798-32853820 CCCACTTGAGAGCCAAACAAGGG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 9
3: 95
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124803061 Original CRISPR GGCCAGGCCCAGAGTGGGCA GGG Intronic
900103167 1:971411-971433 GGGCGGGCCCACAGTGGGGAGGG - Intronic
900105219 1:978185-978207 TCCCAGGCCAAGAGTGTGCAGGG - Intronic
900225045 1:1529041-1529063 GGCCAGGCCCGGACTGAGCAGGG - Intronic
900408986 1:2504438-2504460 GCCCAGGCCCAGGCTGGGCAGGG - Exonic
900418066 1:2544064-2544086 TGCCAGGGCCAGAGCGTGCAGGG - Intergenic
900462505 1:2808470-2808492 GGCCATGCCCAGAGCCTGCAGGG + Intergenic
900568586 1:3347393-3347415 GGCCAGGCCCAGGGTGTTCCGGG - Intronic
900618397 1:3575928-3575950 GGTGAGGCCCGGAGTGGGCCTGG - Intronic
900623778 1:3598999-3599021 GGCCCGGCCCAGAGTAGGTGAGG - Intronic
900956229 1:5887912-5887934 GGCCATGCACAGAGAGGGCAGGG + Intronic
901056125 1:6449313-6449335 AGGCAGGCCCAGATTGGGGAAGG - Intronic
901069210 1:6508948-6508970 GGCCAGGCCTAGAGCGGGGTGGG - Intronic
901195753 1:7438990-7439012 CACCAGGGCCAGAGTGAGCAGGG + Intronic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
901650313 1:10739360-10739382 GCCCGGGCCCAGGGTGGCCACGG + Intronic
902301466 1:15505592-15505614 GGCCAAGCCCCCAGTGGGCCTGG + Intronic
902409794 1:16206142-16206164 GGCCTGGCCCGGGGTGGGGACGG - Intronic
902440403 1:16425657-16425679 GGCCAGGATCAGAGTGAGCTGGG - Intronic
902478215 1:16699127-16699149 AGGCAGGCCCAGAGAGGGGAGGG + Intergenic
902478231 1:16699182-16699204 AGGCAGGCCCAGACTGGGGAAGG + Intergenic
902510677 1:16965446-16965468 GGCCAGGCAAAGAGAGGCCATGG + Intronic
902536462 1:17121684-17121706 GGCAAGGCCGAGTGAGGGCAGGG + Intergenic
902609351 1:17588176-17588198 GGGCAGGCCCAGAGCAGGCAGGG + Intronic
902621257 1:17652283-17652305 GGTGTGGCCCAGCGTGGGCAGGG - Intronic
902799661 1:18821368-18821390 GGCAAGGCCTGGTGTGGGCAGGG - Intergenic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
903227930 1:21904345-21904367 GGCCAGGGCTGGAGAGGGCACGG + Intronic
903266998 1:22163576-22163598 GGCCAGGAGCAGTGGGGGCAGGG + Intergenic
903271089 1:22188727-22188749 GGCCTGGCACAGAGTGAGAATGG + Intergenic
903334654 1:22616856-22616878 GGCCAAGCCCAGTGGGGGCACGG + Intergenic
903546808 1:24129429-24129451 GGCCAGCCCCAGAGAGAGGAGGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
903885331 1:26537604-26537626 GCCAAGGCCCAGAGTGTACAAGG - Intronic
903931116 1:26863091-26863113 GGCCAGGCCCAGAGAAGGGTGGG - Intergenic
904053538 1:27655662-27655684 TGCCAGGCCCAGAGTAGGCGCGG + Intergenic
904203860 1:28839843-28839865 GGGCTGGCCCAGGGTGAGCATGG + Intronic
904209756 1:28879229-28879251 GTCCAGTCCCAGGCTGGGCACGG + Intergenic
904266966 1:29323745-29323767 TGGCAGGCCGAGAGTGGGGATGG + Exonic
904280461 1:29415034-29415056 GGGGAGGCCCAGAAAGGGCAAGG - Intergenic
904403630 1:30272771-30272793 GGCCAGGCCCCCAGGGAGCATGG - Intergenic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905478259 1:38244079-38244101 TGCCAGGCCCAGCCTGGGCTGGG - Intergenic
905620782 1:39444739-39444761 AGCCAGACCCAGAGTCGTCACGG - Exonic
905796364 1:40818724-40818746 GGGCACGACCAGAGCGGGCAGGG + Intronic
905822430 1:41004069-41004091 GGCCAAGCCCCGAGCCGGCAGGG + Intronic
905886483 1:41494707-41494729 GGCCTGACACAGAGTGGGCTTGG - Intergenic
906689253 1:47781823-47781845 AACCAAGCCCAGAGAGGGCAGGG - Intronic
906705286 1:47890336-47890358 GGCCATGACCAGCGTGGTCATGG + Intronic
906837336 1:49098224-49098246 GGCCAGGCACAGAGTGGAGCTGG - Intronic
907401216 1:54226118-54226140 GGCCTGGCGCAGAGTGGGAGAGG - Intronic
907409453 1:54274154-54274176 GGCGAGACCCAGAATGGGGAGGG + Intronic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
910930984 1:92442297-92442319 GGCCAGACCCAGAGGGAGAAAGG + Intergenic
910935581 1:92483191-92483213 GGGCAGGCGCAGAGAGGCCATGG + Intronic
912335365 1:108857237-108857259 GGCCAGTCCCTGAGTAGGAATGG + Intronic
912410530 1:109477975-109477997 GGCCAGGCCCATAGAGGGCGTGG - Exonic
912925462 1:113908901-113908923 TGACAGGCACACAGTGGGCAAGG + Intronic
914929781 1:151920837-151920859 TGGCATGCCCAGAGAGGGCATGG - Intergenic
916199561 1:162257356-162257378 AGCCAGGCCCAGACCAGGCACGG + Intronic
918820740 1:189250778-189250800 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
919465664 1:197919874-197919896 GACCAAGCCCAGGGTGTGCAGGG - Intronic
919738378 1:200967921-200967943 GGCCAGCTGCAGACTGGGCAGGG - Intergenic
919896852 1:202014314-202014336 AGCCAGGCCCTGGGTGGGCACGG - Intronic
920309786 1:205042266-205042288 AGCGAGGCTCAGAGAGGGCAGGG + Intergenic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
921158613 1:212457158-212457180 TGCCAGGCCCTGAGTCTGCAGGG + Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
922703464 1:227775942-227775964 GGCCAGGCCCACAGCGCCCAGGG + Intronic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
923147607 1:231209137-231209159 GGCCAGGGCCAGCGTGGTCAAGG + Exonic
924173569 1:241366355-241366377 GCCCAGGCCCAGATAGGACAGGG - Intergenic
924208954 1:241745021-241745043 TGCCAGGCCCAGGTTGGGCTAGG + Intronic
1062856749 10:783708-783730 GGCCAGGACTAGACTGGCCAAGG + Intergenic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1064325588 10:14348353-14348375 GGGCAGGCCCAGTGTTAGCATGG + Intronic
1064327778 10:14366689-14366711 GGCTAAGCCCAGAGTCAGCATGG - Intronic
1064418116 10:15168290-15168312 GGCGAGGCCCGGGGTGGGCGGGG - Intronic
1065913007 10:30326521-30326543 AGCCAGGGCCAAAGTGGTCAAGG + Exonic
1065976661 10:30847859-30847881 AGCCAGGCACAGAGTGGTGAGGG - Intronic
1066961774 10:42232505-42232527 GGCCAGGGCCAGGGAGGGCCAGG + Intergenic
1067055072 10:43045394-43045416 GCCCAGGCCCAGCGGTGGCAGGG + Intergenic
1067237909 10:44467231-44467253 GCCCAGGCCCAGGGTAGGCAGGG - Intergenic
1067298401 10:44989225-44989247 GGTCAGGCCCAGAGGGGACAAGG - Intronic
1067796944 10:49327604-49327626 GGCCTGGCCCTGAGAAGGCATGG - Intergenic
1068130628 10:52890507-52890529 AGCCAGGCGCAGAGTGGTGAGGG - Intergenic
1068283539 10:54908199-54908221 AGCCTGGCCCAGAGTGGCAAGGG + Intronic
1069723043 10:70561692-70561714 GGCCAGGCCTGGAGTGGGTATGG - Intronic
1069840797 10:71338118-71338140 AGACTGGCCCAGGGTGGGCATGG - Intronic
1069847819 10:71384804-71384826 TGCCTGGCCCAGGCTGGGCATGG + Intergenic
1069868503 10:71518924-71518946 GGCCACGCCCCCAATGGGCATGG - Intronic
1069945017 10:71979528-71979550 GGCCAGGCACAGATGGGGGAGGG + Intronic
1070103901 10:73414067-73414089 GGGCGGGCCCAGGGTGGGCGGGG + Exonic
1070391037 10:75970704-75970726 GGGCAGGCCCAGTGTGGGCTTGG + Intronic
1070599265 10:77854368-77854390 GGCCTGGCCCAGAGAGCGAATGG + Exonic
1070714355 10:78708333-78708355 GGACAGCCCAAGAGAGGGCAGGG - Intergenic
1070776443 10:79112599-79112621 GACGAGGCCCAGAGAGGGGAAGG + Intronic
1071602054 10:86963108-86963130 GGACAGGCCAAGGGTGGCCAGGG - Exonic
1072525349 10:96266450-96266472 AGCCATGCCCAGAGTGGGTGAGG + Intronic
1073043717 10:100623983-100624005 GGACTTGCCCAGAGTGGGGAAGG - Intergenic
1073176390 10:101560027-101560049 GGCCAGAGCCAGGGTGGGCCTGG - Intergenic
1073937803 10:108655148-108655170 GGCTAGGCCTAGAGAGGGAAAGG - Intergenic
1075250561 10:120867478-120867500 AGCAAGGCCCTGAGTTGGCATGG - Intronic
1075481169 10:122783089-122783111 AGCCTGGCACAGTGTGGGCAAGG + Intergenic
1075699067 10:124456863-124456885 GGCCAGGCTCAGTGTGGGAGTGG - Intergenic
1076000109 10:126906649-126906671 GGCCAGGCACAGAATGGGCGCGG - Intronic
1076172698 10:128335676-128335698 GGCAATGCCCAGTGTTGGCAAGG + Intergenic
1076399927 10:130175846-130175868 CCCCAGGCCCACTGTGGGCATGG + Intronic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1076566725 10:131404158-131404180 GGCCAGGCTCAGTGAGGCCAGGG - Intergenic
1076746407 10:132517028-132517050 GGCCAGGGCCACAGTGGGGCGGG + Intergenic
1076883250 10:133249632-133249654 AACGAGGCCCAGAGTGGGCACGG + Intergenic
1076911769 10:133394036-133394058 GGCGAAGCCCGGAGTGGGCGGGG - Intronic
1077110054 11:858349-858371 GCACAGCCCCAGGGTGGGCAGGG - Intronic
1077231238 11:1459024-1459046 GGCCAGAGCCAGAGGGGGCGGGG - Intronic
1077415161 11:2421347-2421369 GCCGAGGCCCAGAGAGGGCAAGG + Intronic
1077432253 11:2521751-2521773 GGCCTGTCCCCGAGTGGGCATGG + Intronic
1078338238 11:10480820-10480842 GGCATAGCCCAGAGTGGGGAGGG - Intronic
1079615681 11:22489880-22489902 AGCCTGGCCCAGTGGGGGCAGGG + Intergenic
1080441204 11:32296253-32296275 AGCCAGGCGCAGACTGGGCTGGG + Intergenic
1081669059 11:44933278-44933300 AGCCAGGCACAGGGTGGACAGGG + Exonic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1082080331 11:48007813-48007835 GGGCAGGCCCAGAGCAGGAAGGG + Intronic
1083266077 11:61547403-61547425 GGCCGGGCACACAGTGGGCGGGG + Intronic
1083612200 11:64009664-64009686 GTCCAGGCCCAGAGTGAGGCAGG + Intronic
1083750493 11:64758312-64758334 GGCCAGGCCCAGTGTTGCCATGG + Exonic
1083886901 11:65577361-65577383 TAGCAGGCCCAGTGTGGGCAAGG - Intronic
1083946283 11:65924856-65924878 GGCAAAGCCCAGAGAGGGAAAGG - Intergenic
1084430519 11:69108255-69108277 TGGCAGGCTCACAGTGGGCAGGG - Intergenic
1085039257 11:73317381-73317403 AAGCAGGCTCAGAGTGGGCAGGG + Intronic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1085471600 11:76761865-76761887 AGCGAGGCCCAGGGTGGGCAGGG + Intergenic
1085512146 11:77093818-77093840 GGCCTCGGGCAGAGTGGGCAGGG + Intronic
1085709583 11:78816942-78816964 GGTGAGGCCCAGAGAGGGGAAGG - Intronic
1086850356 11:91800385-91800407 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
1087911865 11:103762968-103762990 GCCCAGTCCCAGAGTAGACAAGG - Intergenic
1089138790 11:116270162-116270184 GGGCAGGCAAAGAGTGGGGATGG - Intergenic
1089322091 11:117633297-117633319 GGCCAGACCCAGGCTGGCCAAGG - Intronic
1089378689 11:118012671-118012693 GAACAGGCCCAGATTGGGGATGG + Intergenic
1089573847 11:119427436-119427458 GGCCAAGCCCAGAATCAGCACGG - Intergenic
1089733578 11:120534740-120534762 GGACAGGTCCAGAGGGGACATGG + Intronic
1089757232 11:120695875-120695897 GGACAAGACCAGAGTGGGCCTGG + Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1090629265 11:128632390-128632412 GCCCAGGCCCAGGGTGGGTTTGG - Intergenic
1091170754 11:133517901-133517923 CACCAGGCACAGAATGGGCAAGG + Intronic
1091209197 11:133842213-133842235 TCCCAGGCCCAGTGTGGCCACGG - Intronic
1091282653 11:134390856-134390878 GGCCAGGCGCAGGGTGGGTAAGG + Exonic
1091558864 12:1595035-1595057 GGCGTGGCCCAGAGAGGGAACGG - Intronic
1091784960 12:3237724-3237746 CCCCAGGCACAGAGAGGGCAGGG + Intronic
1092010886 12:5111707-5111729 GGGCAAGCCCAGAATGGGTAGGG - Intergenic
1092148445 12:6230796-6230818 TGCCTGGCCCACACTGGGCAAGG - Intronic
1092160115 12:6311201-6311223 GGCCCGCCCTCGAGTGGGCAGGG - Intronic
1094187751 12:27663280-27663302 GGCCAGGCCCAGAATGAGAATGG + Intronic
1094409475 12:30153773-30153795 GGATTTGCCCAGAGTGGGCATGG - Intergenic
1095954760 12:47799644-47799666 TGCCAGGCCCAGAGCTGCCATGG - Intronic
1096073408 12:48788396-48788418 GGCCTGCCGCAGGGTGGGCAGGG - Intronic
1096627648 12:52905138-52905160 GGCTAGGCCCAGAGGGGGCTGGG + Intronic
1096745222 12:53722401-53722423 GGCCAGGCCTAGAGTGGGGAGGG - Intronic
1097262036 12:57725706-57725728 GGGGAAGCCCAGGGTGGGCAGGG - Intronic
1098320613 12:69239814-69239836 GGCGCGGCCCAGAGGCGGCAAGG - Intronic
1099103433 12:78471639-78471661 TGGCATGCCCAGAGAGGGCATGG + Intergenic
1099501099 12:83415219-83415241 TGCCAGGCCAGGAGAGGGCAGGG - Intergenic
1099573038 12:84348975-84348997 TGCCAGGCCAAGAGAGAGCAGGG - Intergenic
1099801406 12:87461431-87461453 TGCCAGGCCCAGAGAGAGCAAGG + Intergenic
1100410339 12:94311206-94311228 AGGCATGCCCAGAGAGGGCATGG + Intronic
1101606679 12:106252133-106252155 GGCAAGGCCCCCAGTGGCCAAGG + Intronic
1101748045 12:107559070-107559092 GGCCTGGCACAGAGTGGGTGGGG + Intronic
1102025277 12:109711142-109711164 CGACAGGCCCTGAGGGGGCAGGG - Intergenic
1102464487 12:113120464-113120486 GGAGAGGCTCAGAGAGGGCAAGG + Intronic
1102471810 12:113163590-113163612 GGCCAGGCGCAGAGAGGGGCAGG - Intronic
1102544605 12:113645654-113645676 GGCCAGGGGCAGAGAGGGCTGGG - Intergenic
1102650871 12:114441519-114441541 CTCCAGGCCCAGAGAGGGGAAGG + Intergenic
1103909626 12:124345132-124345154 GGTCAGGCCCAGGGTGCGCAGGG - Intronic
1103951941 12:124556088-124556110 AGAGAGGCCCAGAGTGGCCAGGG - Intronic
1104312997 12:127671181-127671203 TCCCAGGCCAAGACTGGGCATGG + Intergenic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104415885 12:128596364-128596386 GTCCTGGTACAGAGTGGGCAGGG + Intronic
1104513269 12:129401060-129401082 GGCCAGGCCCAGTGTGGGAAAGG - Intronic
1104602288 12:130162139-130162161 GGCCAGGCAGAGAGAGGGCGAGG + Intergenic
1104736080 12:131136695-131136717 AGGCAGGCTCAGCGTGGGCAAGG - Intronic
1104895083 12:132160070-132160092 GGGCTCGCCCAGCGTGGGCATGG - Intergenic
1106382817 13:29256459-29256481 GGCTGAGCCCAGAGTGGGCAAGG + Intronic
1106489973 13:30212430-30212452 AGCCAGGCACAGAGTGGTGAGGG - Intronic
1108498420 13:51046684-51046706 CCCCAGGCCCAGAGGGGACAAGG - Intergenic
1108583366 13:51846119-51846141 GGCCAGCCCTAGAGTGAGCCCGG - Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1109332016 13:60942007-60942029 TGGCATGCCCAGAGAGGGCATGG - Intergenic
1110047109 13:70844549-70844571 AGCCAGGCACAGAGTGGCAAAGG + Intergenic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1111485820 13:88896698-88896720 AGCCAGGCACAGAGTGGAGAGGG - Intergenic
1111974552 13:94951901-94951923 GGCCAGAGTCAGAGTGGGGAGGG + Intergenic
1113120172 13:106917334-106917356 GACCTGGCCCAGAGTGCGGAAGG + Intergenic
1113472929 13:110559521-110559543 GCCCTTGCCCAGAGTTGGCAGGG - Intronic
1113784880 13:112997202-112997224 GGCCAGACCCACAGTGGTCTTGG - Intronic
1113890043 13:113730940-113730962 GCCCAGCACTAGAGTGGGCATGG + Intronic
1113922341 13:113920140-113920162 TGCCAGGCCCTGAGTGTGCTGGG + Intergenic
1113922355 13:113920203-113920225 TGCCAGGCCCTGAGTGTGCTGGG + Intergenic
1114707398 14:24741197-24741219 TGGCAGGCCCAGAGTGGGTGTGG - Intergenic
1115354817 14:32436101-32436123 GGGCAGGCCCAGACTGGGGATGG + Intronic
1116436267 14:44897770-44897792 GCCCAGGGCCAGGGTGGGCGTGG + Intronic
1117989548 14:61420247-61420269 GGCCAGGCCCAGAGTGGCTCTGG - Intronic
1119436587 14:74601449-74601471 GGTCAGGCCCTCAGTGGTCAGGG - Intronic
1119473283 14:74912301-74912323 GGCCTGGCCCAGCGTGGGCAGGG - Intronic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119622252 14:76139740-76139762 GGCCAAGCCCAGAGTCAGTATGG - Intergenic
1119775095 14:77243260-77243282 GACCAGGGCTAGAGTGGGAAGGG + Intronic
1119895343 14:78215190-78215212 GGAGAGGGCCAGAGTGGGCTCGG - Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121337254 14:93085000-93085022 TGCCAGGCCCAGGGTCTGCAGGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1122036043 14:98950091-98950113 CACCAGGCCCAAAGTGGGCCCGG + Intergenic
1122159044 14:99769456-99769478 GGCCTCCCCCACAGTGGGCAGGG + Intronic
1122362217 14:101174247-101174269 GACGAGGCCCAGAGAGGGCAAGG + Intergenic
1122386422 14:101351293-101351315 GGGCAGGGCCAGTGAGGGCAAGG + Intergenic
1122398278 14:101450720-101450742 GGCCAGGCCCAGAGGGGTCAGGG - Intergenic
1122542523 14:102506164-102506186 GTCCAAGCCCGGAGTGGGCTTGG - Exonic
1122556512 14:102583625-102583647 GCACAGCCCCGGAGTGGGCAGGG + Intergenic
1122624785 14:103078985-103079007 GGGGAGGCCCAGAGAGGGCCAGG + Intergenic
1122625978 14:103085497-103085519 GGCCTGGCCCGGGGTGTGCAGGG + Intergenic
1122794106 14:104197130-104197152 GGTGAGGCCCAGAGAGGGGAAGG - Intergenic
1122886298 14:104711903-104711925 AAACAGGCCTAGAGTGGGCAAGG + Intronic
1122958941 14:105085782-105085804 GGCCAGTCCCAGTGAGAGCAGGG - Intergenic
1123040739 14:105489258-105489280 GGCCAGGCCCAGCTTCTGCAAGG + Intronic
1123071056 14:105642741-105642763 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123076016 14:105667782-105667804 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123108135 14:105852458-105852480 GCACAGGCCGAGACTGGGCAGGG + Intergenic
1123599758 15:21953925-21953947 GGCCAGGCCTAGGGTGGGTTAGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125298981 15:38234006-38234028 GACCCTGCCCAGATTGGGCAAGG + Intergenic
1125519412 15:40339777-40339799 GGCCAGGGGTAGGGTGGGCATGG - Intronic
1125899240 15:43329929-43329951 GGCCAGGAGCAGAGTGGGTGAGG + Exonic
1128145664 15:65331217-65331239 GGAGAGGCACAGGGTGGGCAGGG + Intronic
1128211966 15:65909281-65909303 GGCCAGGGCCAGCGGGGCCAGGG + Intronic
1128658371 15:69479153-69479175 ATCGAGGCCCAGAGAGGGCAAGG - Intergenic
1129161628 15:73751242-73751264 GCCCAGGGCCAGGGTGGGCTGGG - Exonic
1129244385 15:74270771-74270793 CCCCAGGCCCAGACTGAGCAGGG + Intronic
1129253065 15:74319248-74319270 GAGCAGGCACGGAGTGGGCAAGG + Intronic
1129265900 15:74392914-74392936 GGCCTGGCCCAGGGTGGGGGCGG - Intergenic
1129465955 15:75724325-75724347 GCCCAAGCCCAGGGTGGGGATGG - Intronic
1129968600 15:79758107-79758129 GGCCAGCCACAGGGTGGGCATGG + Intergenic
1130089430 15:80807605-80807627 GGCCAGAACAAGAGTGTGCATGG + Intronic
1130393655 15:83482049-83482071 GGCAAGACCCAGTGTTGGCAAGG - Intronic
1130541084 15:84821262-84821284 GGCGAGGCCTAGAGAGGGCAGGG + Intronic
1130657082 15:85799209-85799231 GGCAAGGCCCTGAGTGGGAGTGG - Intergenic
1131535247 15:93232067-93232089 GGTCAGCCCCACAGTGAGCAGGG - Intergenic
1131683462 15:94747726-94747748 GGCCTGGCCCCCAGTGGGCTTGG - Intergenic
1132328867 15:100996376-100996398 GGCCAGGCCAAGAGGAGTCAGGG - Intronic
1132462859 16:63914-63936 GACCAGGGTCTGAGTGGGCAAGG + Intronic
1132600618 16:771005-771027 GGCCATGCCCAGCGTTGGAAGGG - Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1132886624 16:2185074-2185096 GGCCAGGGCCAGGGTGGCCAGGG - Intronic
1132949165 16:2550940-2550962 GCCAAGGACCAGCGTGGGCAGGG + Intronic
1132965423 16:2651188-2651210 GCCAAGGACCAGCGTGGGCAGGG - Intergenic
1132968613 16:2673614-2673636 GGCCCGGCCCCGCCTGGGCAGGG + Intergenic
1133201266 16:4206148-4206170 GGCCAGGAGCAGAGGGGGAAGGG - Intronic
1133438545 16:5801081-5801103 GGCCCCGCCCAGAGTGTGTACGG + Intergenic
1133889889 16:9868877-9868899 TGCCAGGCAGAGAGTGGGAAGGG - Intronic
1134006579 16:10822238-10822260 GGCCAAGACCAGTGTGGGTAGGG - Intergenic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134716234 16:16359133-16359155 GGGGAGACCCACAGTGGGCAGGG - Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134896894 16:17896280-17896302 GGCCCAGCCCAGACTGGGAAAGG + Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1134958518 16:18393026-18393048 GGGGAGACCCACAGTGGGCAGGG + Intergenic
1135527285 16:23223521-23223543 GGACAGGCCCAGGGTGGAGAAGG + Intergenic
1136268301 16:29133439-29133461 GGCCAGCTCCAGCCTGGGCACGG - Intergenic
1136460630 16:30407969-30407991 GGCCAGGGCCACGGTGGGCGGGG + Intronic
1136478004 16:30525370-30525392 GGCCGGGCCAGGGGTGGGCAGGG - Exonic
1136718217 16:32301620-32301642 GGCCAGGGCCAGAGCTGTCAGGG + Intergenic
1136836591 16:33507890-33507912 GGCCAGGGCCAGAGCTGTCAGGG + Intergenic
1137261263 16:46831468-46831490 GGCCAGGCCGAGAGGAGGCGTGG - Intergenic
1137702398 16:50506523-50506545 GGCCAGTCCCAGAGTGGAAGAGG + Intergenic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1138541330 16:57689440-57689462 GGCCAGACCTAGGTTGGGCAGGG + Intergenic
1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG + Intronic
1139476888 16:67207310-67207332 GGCCAGGCCCCCAGCGGGCAGGG - Exonic
1139649388 16:68354861-68354883 GGCCAGGCTAAGGGTGGGGAAGG - Intronic
1139728114 16:68918804-68918826 GGGCTAGCCCAGAGAGGGCATGG + Intronic
1140700318 16:77575303-77575325 GGCCAGGGCCAGAGAGGGGCAGG + Intergenic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141188827 16:81808818-81808840 GGCCAGGCCCACAGAGGCTATGG - Intronic
1141435757 16:83998909-83998931 GGCCAGGGCCAGAGTGGAGGGGG + Intronic
1141715939 16:85726910-85726932 GGCCTGGCACAGAGCGGGGAAGG - Intronic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1141955243 16:87366489-87366511 GGAAACGCCCAGAGTGGGAAGGG + Intronic
1142010692 16:87712336-87712358 GCCCATGCCCAGTGTGGGCGTGG + Intronic
1142010694 16:87712338-87712360 AGCCACGCCCACACTGGGCATGG - Intronic
1142071609 16:88093773-88093795 GGCCAGCTCCAGCCTGGGCAGGG - Intronic
1142139511 16:88466533-88466555 GGCCAAGCACAGAAAGGGCAGGG + Intronic
1142230250 16:88896787-88896809 GGCCAGGCCCAGGCTGGCCGGGG - Intronic
1203008211 16_KI270728v1_random:216145-216167 GGCCAGGGCCAGAGCTGTCAGGG - Intergenic
1203146778 16_KI270728v1_random:1808191-1808213 GGCCAGGGCCAGAGCTGTCAGGG + Intergenic
1142524618 17:531250-531272 TGACAGGCCCAGAATGGGGAGGG - Intronic
1142597698 17:1037579-1037601 ACCCAGGGACAGAGTGGGCAGGG + Intronic
1142605374 17:1078427-1078449 GGCCAGGCACAGCGTGGCGATGG - Intronic
1142712809 17:1732597-1732619 GGCGAGGACCAGGGTGGGCCAGG + Intronic
1142993982 17:3750363-3750385 CGCCTGGCCCAGAGTGCCCACGG + Exonic
1143027248 17:3948100-3948122 GGCCGGGCACAGAGGAGGCACGG + Intronic
1143350633 17:6285623-6285645 GGCCAGGCCCAGAATTGGCATGG + Intergenic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1143502422 17:7347124-7347146 GCCCAGGTCCAGAGTGTGGATGG + Exonic
1143506490 17:7368609-7368631 TGTCATGCCCAGAGAGGGCACGG + Intergenic
1143682515 17:8487927-8487949 GGGTAGGCACAGAGCGGGCATGG + Intronic
1143783382 17:9240747-9240769 GGCCAGCCCCACGCTGGGCAGGG - Exonic
1144447138 17:15341602-15341624 GGCCAGGGCCAGACTGGTCTGGG - Exonic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144468326 17:15515099-15515121 GGCCATGCCCACTGTGGGTATGG - Intronic
1144586053 17:16488431-16488453 GGCCAGACCCAAAGTGAGTAAGG + Intronic
1144734366 17:17546675-17546697 GGCCAGCCCCAGGGTGGACAGGG - Intronic
1144865834 17:18335196-18335218 GGCCAGGCCCATCAAGGGCAAGG + Intronic
1145239058 17:21228980-21229002 GCCCAGGGCCAGAGAGAGCAGGG + Intergenic
1145252974 17:21306414-21306436 TGCCAGGCCCTGAGAGGGCACGG - Intronic
1145323601 17:21781502-21781524 TGCCAGGCCCCGAGAGGGCATGG + Intergenic
1145817452 17:27805759-27805781 GGACAGGCCCAGGGTGGACCAGG + Intronic
1147215010 17:38893916-38893938 AGGCAGGCCCAGAAGGGGCATGG - Intronic
1147319174 17:39635838-39635860 TGCCAGGCTCAGAGGGGGAAGGG - Exonic
1147388797 17:40097004-40097026 GGCCAGGGCCAGATTGGGAATGG - Intronic
1147563812 17:41524575-41524597 GGCCAGGCCCAGTGGGGTCTGGG - Intronic
1147606628 17:41777350-41777372 AGCCAGGGACAGAGTGGGGAAGG - Intronic
1147627695 17:41910512-41910534 GAGGAGGCCAAGAGTGGGCAAGG - Intronic
1147660070 17:42112610-42112632 GGCGAGACCCAGGCTGGGCAAGG - Exonic
1148161335 17:45451837-45451859 GGCCAGGCTCTGAGGGGGCCAGG - Intronic
1148209037 17:45797126-45797148 GTACATGCCCTGAGTGGGCAGGG + Intronic
1148337538 17:46851646-46851668 GGCCAGGGCCAGCGCGGGCGGGG - Exonic
1148394126 17:47294934-47294956 GACCAGGCCCAAAGTAGGGAGGG - Intronic
1148875442 17:50684295-50684317 GGACAGGGCCTGACTGGGCAGGG - Intronic
1149772240 17:59331471-59331493 GGCCCGGCCCAGCCTGGGCTAGG - Intergenic
1150283516 17:63943136-63943158 GGCCAGGCCCAGACAGGACATGG + Intronic
1150392573 17:64798483-64798505 GGCCAGGCTCTGAGGGGGCCAGG - Intergenic
1151232348 17:72694028-72694050 GTCCAGCCCCAGACTGAGCAAGG - Intronic
1151571916 17:74930723-74930745 GGCCACGTCCAGAGTGCGCGTGG - Exonic
1151595490 17:75075954-75075976 GGCCAGGCCAGGATTGGGGAAGG - Intergenic
1151658948 17:75508581-75508603 GGACAGGCCCACGGTGTGCATGG + Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152001185 17:77646178-77646200 GGCCGGGTTCCGAGTGGGCACGG + Intergenic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152068665 17:78124758-78124780 CGCCAGGCCCAGGCTGTGCAAGG + Exonic
1152074757 17:78152045-78152067 AGCCAAGCCCAGGCTGGGCACGG - Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152210500 17:79000679-79000701 TGCCAGGGCCAGTGTGGTCAGGG - Intronic
1152305772 17:79519429-79519451 AGCCAGGACCAGGGTGGGTACGG + Intergenic
1152376558 17:79921595-79921617 GCCGAGGCCCAGAGAGGTCAAGG - Intergenic
1152530596 17:80916473-80916495 AGCCAGGCGCAGAGTGGTGAGGG - Intronic
1152577593 17:81149632-81149654 AGCCAAGCCCAGGGTGGGCTGGG - Intronic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1152743406 17:82028496-82028518 ATCCAGGCCGAGGGTGGGCACGG + Exonic
1153427850 18:4986812-4986834 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
1155168229 18:23248071-23248093 GACCCGGGCCAGAGTGGGCCTGG + Intronic
1156483652 18:37451226-37451248 GGACAGGCCCATTGTGGGCCAGG + Intronic
1157006300 18:43588967-43588989 AGCCAGGCACAGAGTGACCAGGG + Intergenic
1160670855 19:362301-362323 GGCCAAGCCCAAAGTGCGCAAGG - Exonic
1160800407 19:965009-965031 GGCCAGGCCCAGGGAGGACACGG - Exonic
1160804949 19:988525-988547 AGCGAGGCCCAGAGAGGGCATGG + Intronic
1160832390 19:1109914-1109936 GACCTGGCCCAGCGTGGGGATGG + Intronic
1160836419 19:1126805-1126827 GGACAGGCCCGGATTGGGGAAGG + Intronic
1160844613 19:1160941-1160963 GGCCCCTCCCAGGGTGGGCAGGG + Intronic
1160975859 19:1792097-1792119 GGCCAGGCACAGTGTCCGCAGGG + Exonic
1161016633 19:1986715-1986737 GGCAAGGCCCCGACTGGGCCAGG + Intronic
1161051738 19:2167514-2167536 GGCCAGGCCCTGGCTTGGCAGGG + Intronic
1161063878 19:2228211-2228233 GGCCAGGGCCAGCCGGGGCAGGG - Intronic
1161108224 19:2455126-2455148 CACCAGGCCCAGGGTGGGTAGGG - Intronic
1161162461 19:2768832-2768854 AGCTAAGCCCAGAGAGGGCAGGG - Intronic
1161205999 19:3041841-3041863 AGCCAGGCCCAGAGAGGCCTAGG + Intronic
1161209119 19:3057123-3057145 GGCCAGGCCAAGGGTGGGTAAGG + Intronic
1161221445 19:3119948-3119970 CCCCAGGCCCAGAGAGGGCTGGG - Intronic
1161768015 19:6217426-6217448 AGCCTGCCCCAGAGTGGGGAGGG - Intronic
1161801237 19:6417709-6417731 GGCCAGGGGCAGGGTGGGCCAGG + Intronic
1162029787 19:7912444-7912466 GGCCAGCCCCACAGGGGGCCAGG + Exonic
1162487847 19:10972655-10972677 GCAAAGGCCAAGAGTGGGCAGGG - Intronic
1162566186 19:11446776-11446798 GCCCAGGACCAGAGAGGGCCAGG - Intronic
1162616023 19:11800817-11800839 GTTCAAGACCAGAGTGGGCAGGG + Intronic
1162717886 19:12645252-12645274 GGACTGGCCCAGGGTGGACAGGG - Intronic
1162771760 19:12953511-12953533 GGCCAAGGCCAGACTGGGGAGGG - Exonic
1162806724 19:13140993-13141015 GGCTCGGCCCAGGGTGGGGAGGG - Exonic
1163005996 19:14397023-14397045 GGGCAGGCCCAGGCTGGTCAGGG + Intronic
1163019794 19:14475841-14475863 GGTCAGGCCCAGCCTGGCCAGGG + Intergenic
1163061750 19:14766413-14766435 GGGCAGGCCCAGGCTGGTCAGGG - Intronic
1163270288 19:16248850-16248872 AAACAGGCCCAGAGAGGGCAAGG - Intergenic
1163618378 19:18342797-18342819 GGCCAGGGGCAGACTGGGAAGGG + Intronic
1163649187 19:18507236-18507258 GGCCAGGCACAGACTGTGCAGGG - Intronic
1163722106 19:18903236-18903258 AGCCTGTCCCAGAGTGGGGACGG - Intronic
1163765832 19:19162763-19162785 GGCCATGCACAGAGAGGCCAGGG + Intronic
1163848700 19:19651656-19651678 AGCCTGGCCCACAGTGGGGAAGG - Intronic
1164551027 19:29212762-29212784 GGCCAGGCCCAGAGTTGCGGAGG + Intronic
1164709399 19:30344588-30344610 GGCCAGGCCCAGCGTTGGACAGG - Intronic
1164731774 19:30510936-30510958 GGTCAGGCGTAGAGTGGGGATGG + Intronic
1165098941 19:33426934-33426956 GGACAGGCCCTAGGTGGGCAGGG + Intronic
1165741766 19:38209213-38209235 GGCCAGGGCCAAAGGAGGCAGGG - Intergenic
1166104032 19:40588939-40588961 GGGCAGGGCCAGAGAGGGCTGGG - Intronic
1166194198 19:41195458-41195480 GTCCCAGCCCAGAGTGGTCAGGG + Intronic
1166316412 19:41992207-41992229 GGCCAGGGCCAGGGTGAGCCAGG - Intronic
1166634551 19:44438791-44438813 TGACATGCCCAGAGAGGGCATGG + Intronic
1166809997 19:45508883-45508905 GGGCGGGGCCAGTGTGGGCAGGG + Intronic
1166996507 19:46722101-46722123 GGCGAGGCCCAGAGTGGGAGGGG - Intronic
1167035513 19:46993037-46993059 AGCCAGGCCCCGTGTGGACAGGG + Intronic
1167473802 19:49689109-49689131 GGCCAGGCCCTGAGGGTGGAAGG - Exonic
1167512229 19:49901484-49901506 GTCCAGGCCCAGATTGGGGAAGG + Intronic
1167542073 19:50095386-50095408 TGCCTGGCCTAGAGTCGGCATGG - Intergenic
1167679891 19:50912695-50912717 GGCCAGGAGCAGAGGGGCCAAGG + Intergenic
1167703432 19:51064894-51064916 GACCCGGCCCCGAGTGGGCGGGG + Intronic
1167773884 19:51542440-51542462 GGCCAGGAACAGACTGTGCAAGG + Intergenic
1168585054 19:57585007-57585029 GGCCAGGACCAGTGAGGGCCTGG - Intronic
1202712236 1_KI270714v1_random:24955-24977 AGGCAGGCCCAGAGAGGGGAGGG + Intergenic
1202712252 1_KI270714v1_random:25010-25032 AGGCAGGCCCAGATTGGGGAAGG + Intergenic
925912153 2:8581061-8581083 GGCCAGCTCCAGAGAGGACAGGG + Intergenic
926106013 2:10151755-10151777 GGCCATGCCAAGTGTTGGCAAGG - Intronic
926140153 2:10363716-10363738 GGCCAGCCACAGTTTGGGCACGG + Intronic
926171394 2:10555090-10555112 GGCCAGGCCCAGCCTGGGATAGG + Intergenic
926188031 2:10706999-10707021 AGCCAGGCAGGGAGTGGGCACGG + Intergenic
926297743 2:11580879-11580901 GGCCAAGGCCAGAGGGGGCATGG + Intronic
927009439 2:18887530-18887552 GGAGAGGCCCATTGTGGGCAAGG - Intergenic
927109446 2:19853729-19853751 GGACAGGCCCAGATGGCGCAGGG - Intergenic
927670413 2:25064143-25064165 AGCCAGGGCCAGGGTGGTCACGG - Intronic
927934648 2:27069572-27069594 GGCTAGGCCCAGGTTGGGCCGGG + Exonic
929070868 2:38029329-38029351 GCCCAGGCCTTGAGTGGGAAGGG - Intronic
929588585 2:43131156-43131178 AGCCAGGCTCACTGTGGGCAGGG + Intergenic
929959826 2:46488091-46488113 GGCCCGGCCCAGATTGGCTACGG - Intergenic
930748483 2:54908824-54908846 GGCCAGGCTCACACTGGGCTGGG - Intronic
930933754 2:56920682-56920704 TGGCATGCCCAGAGAGGGCATGG + Intergenic
932193585 2:69763190-69763212 GCCCTGGCCCAGAGAGGGAATGG + Intronic
932345538 2:70993050-70993072 AGCCATGCCCAGAGTGCACATGG + Intronic
932651904 2:73566983-73567005 TGGCAGGCCCAGAGAGGACATGG - Intronic
933666719 2:84970853-84970875 GGCCAGGCCGAGGCTGGGCACGG + Intergenic
934054220 2:88238597-88238619 GGGAAGGCCCAGAGAGGGTAAGG + Intergenic
934573411 2:95385599-95385621 GGCTAGCCCCAGGGTGAGCAGGG + Exonic
935091473 2:99898881-99898903 GGACAGGCCCTGTGAGGGCAGGG - Intronic
937087116 2:119178824-119178846 AGCAGGGCCCAGGGTGGGCAGGG - Intergenic
937156765 2:119725288-119725310 GGCTAGGCCCAGAGGGAGAAGGG + Intergenic
937518929 2:122687129-122687151 TGCCAGGGTCAGAGTGGGGAGGG + Intergenic
937737952 2:125314072-125314094 AGCCAGGCACAGAGTGGCAAGGG - Intergenic
938288142 2:130135763-130135785 CACCTGGCCCAGAGGGGGCAGGG + Intergenic
938340248 2:130531369-130531391 GGGCAGCCCCAGGGTGGGCCGGG + Intergenic
938349588 2:130589379-130589401 GGGCAGCCCCAGGGTGGGCCGGG - Intergenic
938381156 2:130837244-130837266 GGCGAGCCCCTGAGAGGGCAAGG + Intronic
938427443 2:131203129-131203151 CACCCGGCCCAGAGGGGGCAGGG - Intronic
938468387 2:131537177-131537199 CACCCGGCCCAGAGGGGGCAGGG - Intergenic
938696638 2:133840951-133840973 GGTCAGGCGCAGAGGGAGCAAGG + Intergenic
939570982 2:143839407-143839429 GACCAGTTCCAGAGTGGTCAGGG + Intergenic
940193538 2:151067533-151067555 GCCAAGGCACAGATTGGGCATGG + Intergenic
941347094 2:164383327-164383349 GGACAGCCCCAGAGTGGCCTAGG - Intergenic
942678151 2:178450528-178450550 GGCCAGGGCCAGAGCTGGCGAGG + Intronic
944105500 2:196075486-196075508 GGCCAGGACCATAGTGAGGAAGG + Intergenic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946396391 2:219445690-219445712 GGCCAGGGGCAGATGGGGCAAGG + Intronic
947524077 2:230868059-230868081 GTCCAGGCCCAGAGTGAGGGCGG + Intronic
947738942 2:232476162-232476184 GGACAAGCCCAGAGCAGGCAGGG + Intergenic
947822809 2:233083746-233083768 GGCCAGCTCCAGGGTGGCCAGGG + Intronic
947833165 2:233156225-233156247 GACAAGGCCAAGACTGGGCAGGG + Intronic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG + Intronic
948169629 2:235890492-235890514 GGACAGCACCAGAGTGGGGAGGG + Intronic
948334804 2:237199721-237199743 AGCCAGGCACAGAGTGGCAAAGG + Intergenic
948582366 2:238996865-238996887 GGGCAGGCTCAGCGTGGGCTCGG + Intergenic
948611093 2:239167458-239167480 GGCCAGGCCTATGCTGGGCATGG - Intronic
948627775 2:239279727-239279749 GGCCAGGCCCGCAGGGGGCATGG + Intronic
948883365 2:240871335-240871357 GGCCAGGCCCTGAGGAAGCAGGG - Exonic
948948352 2:241233263-241233285 GGCAGGGCCCAGAGAGGGGATGG + Intronic
949025286 2:241764958-241764980 GGCCAGGGCCAGGGTGTGCTTGG + Intronic
1169264357 20:4158613-4158635 GGCCTAGCACAGAGTTGGCAGGG - Intronic
1170688161 20:18587897-18587919 CGCCAGGCCGAGAGTGGGCGTGG + Exonic
1171284900 20:23928956-23928978 GCCCAGCCTCAGAGTGGGCGGGG + Intergenic
1171286130 20:23939212-23939234 AGCCAGGTGCAGAGTGGTCAGGG - Intergenic
1171784415 20:29449149-29449171 GGCCAGGGCCAGGCTGGGCCAGG + Intergenic
1172030991 20:31981981-31982003 AGCCAGGCCCAGCTTGGGAAGGG - Intronic
1172242577 20:33423256-33423278 GGCCTGTCCCAGAGTGGGGGTGG + Intronic
1172250472 20:33475856-33475878 GGCCAGGCACAGAGGGAGGAGGG + Intergenic
1172481105 20:35271844-35271866 GGGCCGGGCCAGGGTGGGCATGG + Intronic
1172572770 20:35983402-35983424 GCCCAGGCCCAGAGCGAACAAGG - Intronic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173822415 20:46028276-46028298 GGCCAGGGACAGAGTGGGGGAGG - Intronic
1174056239 20:47800344-47800366 GGCCAGGCTCAGAGAGGGCCAGG - Intergenic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1174498267 20:50965138-50965160 GGCCAGGGCCAGATGGCGCAAGG + Intergenic
1174767142 20:53265121-53265143 GGCCAGGGCCAGAGCGTTCAGGG + Intronic
1175417373 20:58810812-58810834 GACCTGGCCCACAGTGGGCCTGG - Intergenic
1175536962 20:59721559-59721581 GGCCAGGCCAGGAGTTGGGAAGG + Intronic
1175668569 20:60881429-60881451 GGCCTGTCCGAGGGTGGGCAGGG - Intergenic
1175872376 20:62214550-62214572 GGCCATGCCCAGCGTGTGCAGGG - Intergenic
1175944830 20:62553814-62553836 AGCCAAGCCCAGAGAGGGCTGGG - Intronic
1175981488 20:62741011-62741033 GGCCAGGCTCAGCGAGGGGAGGG + Intronic
1176369820 21:6055990-6056012 GGCCAGGGCCAGGAGGGGCAGGG - Intergenic
1177404449 21:20646673-20646695 AGCCAGGCACAGAGTGGAGAGGG - Intergenic
1177875278 21:26625145-26625167 AGCCAGGCGCAGAGTGGCGAGGG + Intergenic
1178916435 21:36707962-36707984 GGCCTGGCCCAGCGTGGGTTGGG + Intronic
1179459419 21:41523640-41523662 AGCCAGGTCCAGAGTAGGAAGGG + Intronic
1179600803 21:42476193-42476215 GGCCAGGCCTAGGCTGGGCTGGG - Intronic
1179605800 21:42514350-42514372 GGCCCGGGCCGGGGTGGGCAGGG - Exonic
1179753699 21:43482551-43482573 GGCCAGGGCCAGGAGGGGCAGGG + Intergenic
1180024196 21:45149369-45149391 GGACAGGCCCAGAGACAGCAGGG - Intronic
1180050849 21:45330452-45330474 GGCCAAGCACAGAGGGTGCAGGG + Intergenic
1180078078 21:45473231-45473253 CGCCAGGGCCCGAGAGGGCAGGG + Intronic
1180174804 21:46082340-46082362 GGCCAGGCCAGGTGGGGGCAGGG + Intergenic
1180998333 22:19976487-19976509 GGCAGAGCCAAGAGTGGGCAGGG - Intronic
1181103532 22:20557733-20557755 GGCCAAGGCCAGACTGGGGAGGG - Intronic
1181440749 22:22934139-22934161 GGCAGGGCCCAGAGAGAGCAAGG + Intergenic
1181493500 22:23275192-23275214 GGCCTGGCCCAGGAAGGGCATGG + Intronic
1181625743 22:24121057-24121079 GGCGAGGGCCAGAGAGGGCCAGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182477084 22:30582197-30582219 GGCCAGGCCCAGCGGGGGCGGGG + Intronic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1183346946 22:37313222-37313244 GGGCAGGGCCAGAGTGGGTGAGG - Intronic
1183379471 22:37483836-37483858 GTCCAGGTCCAGAGGGGGCGGGG + Intronic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1183630850 22:39031803-39031825 GCCCTTGCCCAGAGTGTGCAGGG + Exonic
1183634366 22:39052183-39052205 GCCCTTGCCCAGAGTGTGCAGGG + Exonic
1183637049 22:39070502-39070524 GCCCTTGCCCAGAGTGTGCAGGG + Intronic
1183701610 22:39454312-39454334 GGCCTGGCACACAGTAGGCACGG - Intergenic
1183741981 22:39673923-39673945 GGCCTGGGGCTGAGTGGGCAGGG + Intronic
1183830935 22:40418077-40418099 GGGCAGGCCCAGCCTGGGTACGG + Intronic
1183985451 22:41567612-41567634 GGCAGGGCCCAGAGAGGGAAAGG + Intronic
1184101823 22:42344787-42344809 GGCCAGGCCCAGAGCCAGGACGG - Intergenic
1184121315 22:42452395-42452417 GGCCAGGCCCTGCCTGGCCAGGG + Intergenic
1184234004 22:43173601-43173623 GGACAGGTCCAGGCTGGGCAGGG - Intronic
1184245607 22:43234465-43234487 AGACAGGCCCAGATGGGGCAGGG - Intronic
1184272597 22:43393264-43393286 GGCCCGGCCCAGGCTGGGAAAGG - Intergenic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184366318 22:44053881-44053903 TGGCACGCCCAGAGAGGGCATGG - Intronic
1184510554 22:44930780-44930802 GGCCAAGCCCTGAAAGGGCAGGG + Intronic
1184648277 22:45907921-45907943 GGCTGGGTCCAGAGTGTGCAGGG - Intergenic
1184687832 22:46104472-46104494 GGCCAAGGCCAGACTGGGCGGGG - Intronic
1184747921 22:46466572-46466594 GGCCAGGCTCAGTGTGGGGCTGG - Intronic
1184862352 22:47179996-47180018 GACCACACCCAGTGTGGGCAAGG - Intergenic
1184891458 22:47381981-47382003 GGCCAGGACCAGAGGTGGCTCGG + Intergenic
1184900652 22:47444588-47444610 GGCCAGACCCGGAGAAGGCAGGG - Intergenic
1184907375 22:47497892-47497914 GGGCAGGGCCTGAGTGGGGAGGG + Intergenic
1185009285 22:48304291-48304313 CACCAGGCCCAGAGTGCACAGGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185338730 22:50282381-50282403 GGTCAGGGCCAGGGTGGGCGGGG - Intronic
1185370762 22:50459877-50459899 GCCCAGGCCCACAGCGGGCAGGG + Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
950039529 3:9911055-9911077 CCCCAGGACCAGGGTGGGCAGGG + Intronic
950197730 3:11021052-11021074 GGCCTGGCACAGAGTGGTCAAGG + Intronic
950521661 3:13501295-13501317 GGCCAGGCACAGAGTGGCAGGGG - Intronic
950534288 3:13570384-13570406 GGCCAGGCCCAGAGCAAGCCAGG - Exonic
950635391 3:14310889-14310911 GGCCAGGCCACGTGTTGGCATGG - Intergenic
952878941 3:37971030-37971052 GGTCAGGACCTGTGTGGGCACGG - Intronic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
953197824 3:40750619-40750641 TGACAGTCCCAAAGTGGGCAGGG + Intergenic
953492338 3:43362668-43362690 GGCCTGCACCAGGGTGGGCAGGG - Intronic
953546058 3:43864320-43864342 GACTTGGCCCAGAGAGGGCATGG + Intergenic
953603175 3:44387644-44387666 AGCCAGGCACAGAGTGGCAAGGG - Intronic
954113944 3:48453575-48453597 GGCCTGGCGCAGAGTGTGCTTGG + Intronic
954116440 3:48469330-48469352 GGGCAGGGCTAGAGTTGGCAGGG + Intronic
954412451 3:50376732-50376754 TGCTTGGCCCTGAGTGGGCAGGG - Intronic
954575151 3:51671703-51671725 GGCAAGGCCCGGGGTGAGCAGGG + Exonic
954582011 3:51707950-51707972 GGCCATGGCTAGGGTGGGCAGGG + Intronic
954595422 3:51820031-51820053 GGCCAGGACCAGACTATGCAGGG - Intronic
954631706 3:52051253-52051275 GGCCAAGCCCAGTGTGGGTAGGG + Intronic
954684396 3:52362506-52362528 GTGCAGGCCCAGAGTGGCCCAGG + Intronic
954684948 3:52365294-52365316 GGCCAGGCCCTGATGAGGCAAGG - Intronic
955326583 3:58013312-58013334 GGCCAGCGCCAGAGCAGGCAGGG + Intronic
956407286 3:68941159-68941181 GTCCATGCCCAGGTTGGGCAAGG + Intergenic
957732068 3:84151536-84151558 CACCAGGCCCTGAGTGGGCAGGG + Intergenic
958779415 3:98522973-98522995 GGCCCGGCCCGGAGTGGGGGCGG - Intronic
961326923 3:126114529-126114551 GGCCGGGCCTGGAGGGGGCAGGG - Intronic
961660901 3:128468327-128468349 AGCGAGGCCCAGAGAGGGCAGGG + Intergenic
961745675 3:129062206-129062228 AGCCAGGCCCAGCGCGGCCACGG - Exonic
962358325 3:134714012-134714034 GGTGAGTCCCAGAGTGGGCTGGG + Intronic
962715802 3:138124944-138124966 GGCCAGGCCCAGAGAGGCTGGGG + Intronic
962740189 3:138357664-138357686 GGCCAGGCGGCCAGTGGGCATGG - Intronic
962919019 3:139934977-139934999 GGCCCGGTCCCGACTGGGCAGGG + Intergenic
966083010 3:176028508-176028530 GGCCAGTCACAGGGTGGGCTGGG - Intergenic
968490895 4:890044-890066 GGCCAGGCCTGCTGTGGGCAAGG - Intronic
968645319 4:1737752-1737774 GGCTTGGCCAACAGTGGGCAGGG + Intronic
968648532 4:1751443-1751465 GGCCCGGGACAGAGAGGGCATGG - Intergenic
968800813 4:2742345-2742367 GGCGCGGCCCAGAGAGGCCAGGG - Exonic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
968905206 4:3447687-3447709 GGCCAGGCCCAGACAGGGGCAGG + Intronic
968911013 4:3477011-3477033 GGCCAGGCCGTGGGTGGGGATGG + Intronic
968980660 4:3847691-3847713 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
969251850 4:5973478-5973500 GCCCATGCCCTGGGTGGGCATGG - Intronic
969449459 4:7264785-7264807 GGCCAGACCCTGAGGGTGCAGGG + Intronic
969671349 4:8592041-8592063 GTCCAGGCAGAGAGAGGGCAAGG + Intronic
969840000 4:9874328-9874350 GGCCAGGCCCAGCCTTGCCAGGG + Intronic
970637574 4:18025493-18025515 GGCCAAGCCCAGAGTCGATATGG + Intergenic
971023630 4:22565871-22565893 TGGCATGCCCAGAGAGGGCATGG + Intergenic
972410424 4:38787970-38787992 GACCATTCCCAGAGTGAGCAGGG - Intergenic
972572736 4:40325857-40325879 GGCCAGGACCAGAGTGAGGCAGG + Intergenic
972788320 4:42347289-42347311 AGCCAGGCCCGGAGTGGTGAAGG - Intergenic
974420271 4:61663519-61663541 AGCCAGGCGCAGAGTGGTGAGGG - Intronic
979605793 4:122637491-122637513 GGCCAAACCCAGAGTCAGCACGG + Intergenic
984701236 4:182819924-182819946 TGCCAGGCCCAGATAGGCCATGG - Intergenic
984763939 4:183385195-183385217 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
985480528 5:107627-107649 GGCCAGACCCAGGGCGGGGATGG - Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
985827718 5:2205123-2205145 GGCCAGGCCCGGATGGAGCAGGG + Intergenic
985969778 5:3365876-3365898 GGCCATGCCCAGAAGGGCCATGG + Intergenic
985972060 5:3386123-3386145 GGCCAGCTCCAGAGTGCGCAGGG + Intergenic
986689449 5:10302113-10302135 GGCCAAGTCCACAATGGGCAGGG + Intronic
987435217 5:17885557-17885579 GGCCAGGCCCAGGGTCCTCATGG + Intergenic
988073363 5:26323991-26324013 AGCCAGGCACAGAGTGGCGAAGG + Intergenic
989520796 5:42397421-42397443 AGCCAGGCACAGAGTGGTGAAGG - Intergenic
989732600 5:44665494-44665516 AGCCAGGCCCAGAGCGGTGAGGG - Intergenic
990694596 5:58401837-58401859 GGTCAGACCCAGAGTGGTCATGG - Intergenic
992080897 5:73233748-73233770 GGCCCGGCCCAGCGCGGGCGGGG - Intergenic
992086778 5:73284622-73284644 AGCCAGCTCCAGACTGGGCAGGG + Intergenic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
992763159 5:79969712-79969734 GGTCAGGAGCAGAGTGAGCAGGG - Intergenic
994451976 5:99955160-99955182 AGCCAGGCACAGAGTGGACAGGG + Intergenic
995184041 5:109253274-109253296 GGCCAGACCCATAGAGAGCAAGG + Intergenic
997212167 5:132083245-132083267 CCCAAGGCCCAGAGAGGGCAGGG + Intergenic
997354420 5:133253291-133253313 TGCTAGGCCCCGAGTGAGCAGGG + Intronic
997377807 5:133409693-133409715 GGCCTGGCACAGATTGGGCTGGG + Intronic
997474347 5:134133999-134134021 GGCCAGGCCCAGCATGGCCAAGG + Intronic
997880793 5:137587651-137587673 GGCCAGGCTGAGAATGAGCAGGG + Intronic
998140418 5:139696907-139696929 GGCCAGGCCTGTGGTGGGCAGGG + Intergenic
999261595 5:150241879-150241901 GGCCAGGCACAGAATGGGGAAGG + Intronic
999440520 5:151597247-151597269 GCCAAGCCCCTGAGTGGGCAAGG - Intergenic
999461182 5:151758672-151758694 GGCCGGGCCCGGAGTGGGAGGGG - Exonic
999715300 5:154355453-154355475 GGCCAGGCCCGGAATGGGAGGGG - Intronic
999767771 5:154754715-154754737 GGCCAGGCCCAGCGGCGGCGAGG + Intronic
1001396809 5:171423627-171423649 GGTCAGGCCGAGAGGGGGCGTGG - Intronic
1001587707 5:172844665-172844687 GGCCAGGCCCCGGGTGGGAGGGG - Intronic
1001588595 5:172850308-172850330 GGCCTGGCCCAGGGTGGGGTGGG - Intronic
1001753289 5:174147664-174147686 GGCCAGACCCATGCTGGGCAGGG - Intronic
1001818369 5:174690408-174690430 GGCCAGGCCCTGATTGGGGCAGG + Intergenic
1001951484 5:175819786-175819808 GGCCAGGCTCAGAGAGGTGAAGG + Intronic
1002083012 5:176748611-176748633 GGCAAGGTCCAGAGAGGGGAAGG - Intergenic
1002259929 5:177985828-177985850 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002259937 5:177985858-177985880 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259941 5:177985873-177985895 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259945 5:177985888-177985910 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259961 5:177985961-177985983 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002405643 5:179027962-179027984 GTCCAGCCCCAGAGTGCCCAGGG - Intronic
1002421914 5:179153384-179153406 GGACCGGCCCAGTGTGGGGAGGG - Intronic
1002443658 5:179276900-179276922 GGCCAGGCTCAGCCTGGGGAAGG + Intronic
1002876650 6:1216350-1216372 GGCCAGGGCCAGAGTGAGGCAGG - Intergenic
1002890075 6:1324616-1324638 GGCTTTGCCCAGAGTGGGAAGGG - Intergenic
1003300268 6:4874392-4874414 TGCCAGGCACACAGTGGGGAAGG - Intronic
1004338934 6:14790015-14790037 GGAAAGGCCCAGAGTGCTCAGGG + Intergenic
1004701963 6:18087729-18087751 GGCCAGGTCCAAAGTGGAGAAGG + Intergenic
1005724241 6:28633493-28633515 GCGGAGGCTCAGAGTGGGCAAGG + Intergenic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006106396 6:31719404-31719426 GGCCAGGGACAGAGTTGGGAAGG - Intronic
1006118822 6:31791832-31791854 GCCCAGGCCCAGAGTGGGTGGGG - Intronic
1006379485 6:33689210-33689232 GGCCAGGGGCAGGGTGAGCAGGG - Intronic
1006401631 6:33821186-33821208 ACCCAGGCCCTGAGTGGGCTTGG + Intergenic
1006408162 6:33857035-33857057 TGCCAAGACCAGAGAGGGCAAGG + Intergenic
1006518031 6:34555492-34555514 TGCCAGGCCACCAGTGGGCAGGG - Intronic
1007282455 6:40722571-40722593 AGGCAGTCCCAGAGTGGGGAGGG + Intergenic
1007535879 6:42588289-42588311 TGGCATGCCCAGAGAGGGCATGG - Intronic
1008876810 6:56338453-56338475 GGCCAGGGTGAGAGGGGGCAGGG - Intronic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1010238130 6:73591960-73591982 TGGCACGCCCAGAGAGGGCATGG - Intergenic
1011416204 6:87122572-87122594 GGCCAAGCCCACCGTGCGCAAGG - Intergenic
1012377094 6:98575146-98575168 TGTCAGGCCTTGAGTGGGCATGG + Intergenic
1013586210 6:111581263-111581285 GCCCAGGCCCAAAGGGGGTAAGG + Intronic
1017396115 6:154002106-154002128 AGCCAGGCACAGAGTGGGGATGG + Intergenic
1017725486 6:157273816-157273838 GGCCAGGCCTCGGGTGGGCTGGG + Intergenic
1017774910 6:157673040-157673062 GGCCAGGCCCAGCACGTGCATGG - Exonic
1018068029 6:160137258-160137280 GGCCAGGCCCAGAGTGCAGTTGG - Intronic
1019349051 7:544640-544662 GGCGAGGCACAGAGAGGCCAAGG + Intergenic
1019429744 7:993189-993211 GGCCTGACCCAGACAGGGCAGGG + Intergenic
1019569814 7:1705656-1705678 GGGCAGGGCCAGAAAGGGCAAGG - Intronic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1020007773 7:4791495-4791517 GGCAAGGCCCACGGTGGGCTTGG + Exonic
1020101277 7:5395450-5395472 GGCCAGGCCCACATCGGACAGGG + Intronic
1022474634 7:30701874-30701896 GGCCAGCCTCAGAGTGTGCAGGG + Intronic
1022520035 7:31000356-31000378 GGCCAGGGCTAATGTGGGCAGGG + Intergenic
1022786275 7:33640751-33640773 AGCCAGGCACAGGGTGGGAAAGG - Intergenic
1023834448 7:44060096-44060118 GGCCAGGGGCTCAGTGGGCAAGG + Exonic
1024559229 7:50629428-50629450 GGCGAGACCCTGAGGGGGCAAGG + Intronic
1024851739 7:53725810-53725832 GGGTGGGCCCAGAGAGGGCATGG + Intergenic
1024952543 7:54879771-54879793 GCCCAGGCCCAGAGAGCACAGGG + Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1025236759 7:57239811-57239833 GGCCAGGCTCAGAGAGGGCCAGG + Intergenic
1025818924 7:64945511-64945533 AGCCAGAACCAGAGGGGGCAGGG - Intergenic
1025955930 7:66183035-66183057 GACCAAGCCCAGAGTCCGCAGGG + Intergenic
1026019681 7:66697506-66697528 GGCCGTGCCCAGAGTTGACAGGG - Intronic
1026865843 7:73823526-73823548 GGCCAGGCCCAGGGCTGGCATGG - Intronic
1026990967 7:74585401-74585423 GACGAGGCCCAGACCGGGCACGG - Intronic
1027050035 7:75016129-75016151 TGCCAGGCCCTGAGTGGGGAGGG - Intronic
1027250540 7:76396038-76396060 GGCCATGCCCAGGGTTAGCAGGG + Intronic
1027803201 7:82781890-82781912 TGGCATGCCCAGGGTGGGCATGG + Intronic
1029373319 7:100163119-100163141 GGCCAGGCCCAGAATGGCTGAGG + Intronic
1029383003 7:100225539-100225561 TGCCAGGCCCTGAGTGGGGAGGG + Intronic
1029435736 7:100563070-100563092 GGCCTGGCACCGTGTGGGCAGGG - Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1030769343 7:113455021-113455043 GTCCAGGGCAAGAGTAGGCATGG - Intergenic
1032074310 7:128829409-128829431 GACCAGGGGCAGAGTGGTCAGGG - Intergenic
1032858748 7:135858569-135858591 GCCCAGGCCCAGAGAGGACCTGG - Intergenic
1033127246 7:138717009-138717031 GCCCTGGCCCTGAGTGGGTAAGG - Intronic
1033423697 7:141224643-141224665 AGCCTGGCCCAGAGTTGGCTTGG - Intronic
1034101678 7:148456501-148456523 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
1034872925 7:154699712-154699734 GGCTGGGCCCAGAGTGGCCTTGG + Intronic
1035418633 7:158709261-158709283 GGCCAGGCCCTGTGTGGCCCTGG - Intergenic
1035671272 8:1419047-1419069 GGCGGTGCCCAGAGAGGGCACGG - Intergenic
1038596575 8:28891132-28891154 GCCCAGGCCCAGAGCGAGCGAGG - Intronic
1039457346 8:37716253-37716275 TGCCAGGCACAGACTGGGCATGG - Intergenic
1041274536 8:56143297-56143319 AGCCAGGCACAGAGTGGCAAGGG - Intergenic
1041389621 8:57337068-57337090 GGCCACCCTCAGAGTGAGCACGG + Intergenic
1043180457 8:77082105-77082127 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
1043345361 8:79291722-79291744 GGCCTGGCTCAGAATGGGGAAGG + Intergenic
1043798535 8:84578095-84578117 AGCCAGGCACAGAGTGGCAAGGG + Intronic
1045423798 8:102042881-102042903 TGCCAGGCCCAGAGAGTTCAAGG + Intronic
1045489445 8:102657302-102657324 GGCCAGGACCAGAGAGGCCCAGG + Intergenic
1046521421 8:115330880-115330902 GGCCAGCGCAAGGGTGGGCATGG - Intergenic
1048328191 8:133454469-133454491 GGCCAGGGCCTGATTGGGCTGGG - Intergenic
1049171901 8:141166807-141166829 GGCCAGGGCTAAAGTGAGCAGGG + Intronic
1049291859 8:141807560-141807582 GGCCAGGCCCATGGCAGGCAGGG + Intergenic
1049353288 8:142175579-142175601 GCCCAGGCCCAGAGAGGCCAGGG + Intergenic
1049405397 8:142449946-142449968 GGCGAGGCCCAGAGCGGGCCGGG + Exonic
1049471061 8:142775203-142775225 GGCCAGGGCCAGGGTGGCCGGGG + Intronic
1049685616 8:143938118-143938140 GGCGGGGCCCGGAGGGGGCAGGG + Intronic
1049692817 8:143970015-143970037 GGGCAGGCCCAGGGCTGGCAAGG - Intronic
1049864072 8:144922299-144922321 TGGCAGCACCAGAGTGGGCAGGG + Intergenic
1050665907 9:7936421-7936443 GACCAGGCCCAGAATGCGGAGGG + Intergenic
1051425382 9:16926985-16927007 GGCTAGGCCCAGAGATGGGAAGG + Intergenic
1051789364 9:20783083-20783105 GGGCAGGGCAAGAGTTGGCAGGG + Intronic
1052840853 9:33289858-33289880 GGCTCGGCCCAGGGTGGGGAGGG - Intergenic
1053131570 9:35618511-35618533 GGCCAGGGCCAGAGGGGCCACGG + Intronic
1055890748 9:81121553-81121575 AGCCAGGCACAGAGTGGCGAGGG + Intergenic
1056462287 9:86819300-86819322 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
1056557618 9:87703014-87703036 GGACAGACCTAGAGGGGGCAGGG - Exonic
1056560641 9:87726418-87726440 GGCCAGGCCCTGAGTCGGCGCGG - Intronic
1056684947 9:88751906-88751928 GGCTGGGCCCAGGGTGGGCACGG + Intergenic
1056953585 9:91065331-91065353 GGTCAGGCCCAGAGGAGGGAGGG - Intergenic
1056994319 9:91442535-91442557 AGCCAGGCGCAGAGTGGTGAGGG + Intergenic
1057308890 9:93929034-93929056 GGCCAAGCCCAGAGTCAGCACGG + Intergenic
1057678986 9:97158747-97158769 GGGGAGGCACAGAGTGGGCCAGG - Intergenic
1057935470 9:99234888-99234910 AGACAGGCCCAGAGAGGGGAAGG + Intergenic
1058525067 9:105849672-105849694 GGAGAGCCACAGAGTGGGCAAGG - Intergenic
1060031309 9:120217164-120217186 GGCCTGGCACACAGTGGTCAAGG - Intergenic
1060280797 9:122214227-122214249 GGCCGGGCCGAAAGTGGGCGGGG - Intronic
1060554660 9:124502011-124502033 AGCCAGGCCCTGAGGGGGCCGGG - Intronic
1060662530 9:125412894-125412916 GGGAAGGCCCAGAGCAGGCAAGG - Intergenic
1060776035 9:126375540-126375562 GCCCAGGCCCAGACAGGGAAAGG - Intronic
1060885304 9:127148222-127148244 GGCCAGCCGCAGTCTGGGCAGGG - Intronic
1060973729 9:127753358-127753380 GGACATGCTCTGAGTGGGCAAGG + Intronic
1061042477 9:128148203-128148225 GGACAGGGCCTGAGGGGGCAGGG + Intergenic
1061303910 9:129721936-129721958 AGCCAGGCCCAGGGTACGCATGG + Intronic
1061395079 9:130339417-130339439 GCTGAGGCCCAGAGTGGGAAGGG + Intronic
1061545881 9:131304050-131304072 GGGCAGGTACAGAGTCGGCAGGG - Intronic
1061622284 9:131818462-131818484 TGCCGTGCCCAGAGCGGGCATGG + Intergenic
1061646729 9:132009017-132009039 GGCCACGGGCAGAGTGGGGAGGG - Intronic
1061723955 9:132571246-132571268 GGCCAGGTAGAGGGTGGGCAGGG - Intronic
1062004644 9:134233120-134233142 GAGCAGGGCCAGAGTCGGCATGG - Intergenic
1062179047 9:135180808-135180830 GTCCAGCCCCACAGTGGGAAGGG - Intergenic
1062399781 9:136367305-136367327 CCCCAGGCACAGGGTGGGCAGGG + Intronic
1062430633 9:136525508-136525530 GCTCAGGCCCTGGGTGGGCATGG + Intronic
1062453432 9:136625007-136625029 CCCCAGGAACAGAGTGGGCAGGG - Intergenic
1062499761 9:136847392-136847414 GGGCGGGGCCTGAGTGGGCAGGG - Exonic
1062522520 9:136964155-136964177 CTCCAGGGCCAGGGTGGGCACGG - Intergenic
1062535770 9:137020519-137020541 GGCCAGGCCGTTAGGGGGCAGGG + Intronic
1062554540 9:137107990-137108012 GGCCTGGTCCACAGTGGGGATGG - Intronic
1062658288 9:137615223-137615245 GGGCAGGTCCTGAGTGGGCCAGG - Exonic
1062711206 9:137976090-137976112 GGCCATGCCCAGTGTGGGCTGGG + Intronic
1185721705 X:2387801-2387823 AGCCAGCTCCAGAGTGTGCATGG + Intronic
1185862517 X:3592419-3592441 TGCCAGGCACATATTGGGCAAGG + Intergenic
1186836459 X:13443271-13443293 GGCCTGCCCCAGAGTGAACAAGG + Intergenic
1187391581 X:18889705-18889727 TGCCTGGCCCTCAGTGGGCATGG + Intergenic
1188941325 X:36241376-36241398 TGCCAGGCCAAGAGAGAGCAAGG + Intronic
1189336140 X:40171998-40172020 CCCCAGGCCCAGAGGGGGCCAGG - Intronic
1189831740 X:44981436-44981458 TGACATGCCCAGAGAGGGCATGG - Intronic
1189847466 X:45150308-45150330 GGCCAGGGCAAGAGTGTACATGG + Exonic
1190453208 X:50601303-50601325 GGCCAGGCCCTGAGTAAGCTAGG + Intronic
1190829470 X:54046977-54046999 GGCCAGGCCCTCAGTGGAAAGGG + Intronic
1192314933 X:70044029-70044051 GGGCAGGCCCACAGTGGGAATGG - Intronic
1195674793 X:107499863-107499885 AGGCAGGCCCAGAGTTGGGAGGG - Intergenic
1195741732 X:108071731-108071753 TGCCAGGCCCACAGAAGGCATGG + Intronic
1197035806 X:121871340-121871362 GGCCAAGCGCAGAGTGGTGAGGG - Intergenic
1198051851 X:132958243-132958265 GGCCAGGCCCCGAGTGAGCAGGG + Exonic
1199691621 X:150313118-150313140 GGACAGGCCCCAAGTGGGGAGGG + Intergenic
1199755049 X:150855997-150856019 GGTCAGGGCCAGACTGGGGAGGG - Intronic
1200036836 X:153336433-153336455 GGCCAGGCTCAGCGTGGCCCAGG + Intronic
1200062457 X:153489660-153489682 GCCCAGCCCCAGGGAGGGCACGG - Intronic
1200077784 X:153560251-153560273 ACCCAGCCCCAGAGTGGCCACGG + Intronic
1200765813 Y:7079839-7079861 AGCCAGGTGCAGAGTAGGCAGGG + Intronic
1201593045 Y:15636715-15636737 AGCCAGGCGCAGAGTGGTTAAGG + Intergenic
1201620270 Y:15949120-15949142 GTCCAGGCAGTGAGTGGGCAAGG - Intergenic