ID: 1124803680

View in Genome Browser
Species Human (GRCh38)
Location 15:32860097-32860119
Sequence CAGGAGGGAGGGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18129
Summary {0: 2, 1: 29, 2: 489, 3: 3632, 4: 13977}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124803680 Original CRISPR CAGGAGGGAGGGAGGAAAGA AGG Intronic
Too many off-targets to display for this crispr