ID: 1124805538

View in Genome Browser
Species Human (GRCh38)
Location 15:32878226-32878248
Sequence CCGTGTGGCTGGAGTTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124805530_1124805538 21 Left 1124805530 15:32878182-32878204 CCTAGAGCAGGAACAAGTACATC 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124805538 Original CRISPR CCGTGTGGCTGGAGTTTAGT GGG Intronic
900099840 1:957152-957174 CCGAGTCGCTGAAGTTTAGCAGG + Exonic
901015376 1:6226416-6226438 CTGTTTGGCTGGAGATCAGTGGG - Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901876414 1:12169317-12169339 CCCAGTGCCTGGTGTTTAGTGGG - Intronic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
902736382 1:18404036-18404058 CCATGTGACTGGAGTCTAGAGGG - Intergenic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903471466 1:23590626-23590648 CCATGTGGCTGGAGTGTGGGAGG - Intronic
905030746 1:34882861-34882883 CCATGTGGCTGGTGTGGAGTGGG - Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
910744466 1:90558362-90558384 CCTTCTGCCTGGATTTTAGTTGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
916235863 1:162587519-162587541 CCGAGTGGATGGAGTTTACCAGG + Exonic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916833342 1:168515273-168515295 TGGTGTGGCTGGAGTTGAGAAGG - Intergenic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
922876256 1:228942100-228942122 CCCTGTGGCTGTAGTTGAGAAGG + Intergenic
924275461 1:242381777-242381799 CCGTGGGTTTGGAGTTAAGTGGG - Intronic
1065139494 10:22706396-22706418 CCGTGAGGCTGGTGTTTGCTTGG - Intronic
1067926056 10:50508874-50508896 CCCTGTTGCTGAAGTTTAGCTGG + Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1074615365 10:115062031-115062053 CCCAGTGGCTGTAGTTTATTTGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075925564 10:126249229-126249251 CTGTGTGGCTACATTTTAGTAGG - Intronic
1076150380 10:128157500-128157522 CTGCTTGGCTGGAGTTCAGTGGG + Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1085937574 11:81168140-81168162 CCATGTGGCAGGAGTGTACTGGG + Intergenic
1087015911 11:93554661-93554683 CAGTCTGGCTGAAATTTAGTGGG - Intergenic
1089309915 11:117551286-117551308 GTGCCTGGCTGGAGTTTAGTGGG - Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091863503 12:3808469-3808491 GCGAGTGGCTGGAGGTTAGATGG + Intronic
1094190493 12:27693321-27693343 AGGTGTGGCTGGCATTTAGTGGG - Exonic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1098418025 12:70258909-70258931 ATGTGTGGCTAGAGTGTAGTGGG + Intronic
1099064555 12:77957703-77957725 CCCCCTGGCTGGAGTGTAGTGGG + Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1102233730 12:111281223-111281245 CCCAGTGGCTGGAGTGGAGTTGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1104299890 12:127555079-127555101 CCATGTGCATGGAGTTTAGCTGG + Intergenic
1104469524 12:129018378-129018400 ACTTGTGGGTGGAGTTTAGCTGG - Intergenic
1104917060 12:132271240-132271262 ACGGGTGACTGGAGTTTCGTCGG - Intronic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1112925869 13:104674936-104674958 CCATGTGCCTGGAATATAGTGGG + Intergenic
1113456612 13:110453887-110453909 GTGTGTGGTTGTAGTTTAGTAGG + Intronic
1114683570 14:24507078-24507100 CCGTGTGTCTTGAGTTGGGTAGG + Intronic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1117108884 14:52428017-52428039 CAATGTGGCTGGAGTCTAATGGG - Intergenic
1117383857 14:55191942-55191964 CCCTTAGGCTGGAGTATAGTGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122671502 14:103376235-103376257 CCCTGTCGCTGGAGTACAGTGGG - Intergenic
1124401125 15:29348458-29348480 GCGTGTGGCTGGAGCTGAGCTGG + Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1131255316 15:90858256-90858278 CCCTGTGGCAGGAGCGTAGTGGG + Intergenic
1131755248 15:95553076-95553098 CGCTGTGTCTGGAGTATAGTGGG - Intergenic
1133235939 16:4387466-4387488 CCATGTGGCTGGTGTGGAGTAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1137360047 16:47805983-47806005 CTGTGAGGCTGGGGTTGAGTTGG + Intergenic
1137369259 16:47889516-47889538 CCGAGTGCTTGGAGTATAGTAGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137920070 16:52478266-52478288 CAGTGTTTCTGGAGCTTAGTGGG - Intronic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1140732598 16:77870273-77870295 CCGAGTGCCTGGCATTTAGTAGG - Intronic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143828431 17:9631595-9631617 CAGTGTGTCTGGGGCTTAGTGGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145414506 17:22703789-22703811 CAGTGCGGCTGGGGTTGAGTTGG + Intergenic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1154245391 18:12692439-12692461 CTGTGTGGCTAGAGCGTAGTGGG - Intronic
1155545237 18:26907712-26907734 CCATGTGGCTGGATAATAGTGGG + Exonic
1155912788 18:31523912-31523934 CAGCGTGGCTGGAATTTAGGAGG - Intronic
1159688919 18:71460668-71460690 TAATGTGGCTGGAGCTTAGTGGG + Intergenic
1161857803 19:6775673-6775695 CCGTGTGTCTGGTATGTAGTGGG + Intronic
1162032506 19:7923583-7923605 CCGAGTGGCAGGAGGCTAGTGGG + Intergenic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1164191891 19:22925427-22925449 CCGGGAGGATGGAGTTCAGTGGG + Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166404766 19:42512222-42512244 CCGAGAAGCAGGAGTTTAGTGGG + Intronic
1168684555 19:58340358-58340380 CCGTGTGGCTGGTGTATGGAAGG - Exonic
928546987 2:32337499-32337521 TGGTGTAGCTGGAGTTCAGTAGG - Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
938303059 2:130229645-130229667 CCGAGTCGCTGAAGTTTAGCTGG - Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945305289 2:208254342-208254364 CCGGGTGCCTGGAGTTTAAAAGG - Intronic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169914144 20:10671148-10671170 ACGTGTGTTTGGAGTTTAGGGGG - Intronic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1172166234 20:32901146-32901168 CCGTGTGGCAGAAGTTTGCTTGG + Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1174568789 20:51486304-51486326 CCCTGTGGCTGGACTGGAGTTGG - Intronic
1175392627 20:58636698-58636720 CCGTGAGGCTGGAGTGTGGCAGG - Intergenic
1175598810 20:60256337-60256359 GCGGGTGGCTGGAGATTAGGTGG + Intergenic
1177826461 21:26089907-26089929 CCGTGGGGCTGGTGTTGATTGGG - Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
949170649 3:992309-992331 ACCTGGGGCTAGAGTTTAGTTGG - Intergenic
949797775 3:7869588-7869610 CCATGTGGCTGGTGTGCAGTGGG - Intergenic
949917207 3:8974423-8974445 CCATGTGGCTGGAGCTGAGGGGG - Intergenic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956091766 3:65675105-65675127 CAGTGTGGTTGAAGTTTTGTTGG - Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957535027 3:81491062-81491084 TCCTGCGGCTGGAGTGTAGTGGG - Intronic
958842025 3:99217684-99217706 CCTTGTAGCTGGAGCATAGTAGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
968530862 4:1090882-1090904 CTCTGTGGCTGGAGTTTTGTTGG + Intronic
973204518 4:47545223-47545245 CAGTGAGTCTGGATTTTAGTGGG + Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976528242 4:86118381-86118403 CAGTGTGGCTGGAGAATTGTTGG - Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979443009 4:120774657-120774679 CAGTGTGGCTGGGGTTGTGTTGG - Intronic
983646418 4:169996188-169996210 TCGTGTGCCTGGAGTTTCTTGGG - Intronic
990111346 5:52329097-52329119 ACCTGTGACTGGAATTTAGTAGG - Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999509235 5:152230684-152230706 CCATGTGGCAGGGGTATAGTTGG - Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1001820568 5:174706904-174706926 CCGTGTGGCCGGTGCTCAGTAGG + Intergenic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1007077218 6:39075454-39075476 GGGGGTGGCTGGAGTTTGGTGGG + Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1015154554 6:130077688-130077710 CAGTGTGGCTGGAGTTTCCAGGG - Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1036491252 8:9227652-9227674 CAGTGAGCTTGGAGTTTAGTTGG - Intergenic
1039966453 8:42287530-42287552 CCGTCTGGCTGTAGTGTCGTGGG + Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044728485 8:95212126-95212148 CAGTGTGGCTGTGGTTTAGGGGG + Intergenic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045782957 8:105888752-105888774 CTGTGTCTCTGGAGTTTTGTAGG - Intergenic
1045833740 8:106495399-106495421 CCGTGTAGATGGAATGTAGTGGG + Intronic
1049684229 8:143932897-143932919 CCGTGTGGATGGCGCTGAGTGGG - Exonic
1054740633 9:68802771-68802793 CCATGTGGCTGCAGTTGTGTTGG + Intronic
1055018235 9:71642303-71642325 CCATGTGGCTAGAGCTTAGTGGG + Intergenic
1056753003 9:89365163-89365185 CTCTGGGGCTGGAGCTTAGTGGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059057839 9:111003294-111003316 CCCTATCCCTGGAGTTTAGTAGG + Intronic
1059877407 9:118650359-118650381 CTGTGTGGCTGGAGTATAATGGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061527316 9:131176897-131176919 CAGTGTTGCTGGCATTTAGTGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186560365 X:10605804-10605826 AAGTGTTGCTTGAGTTTAGTAGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic