ID: 1124806561

View in Genome Browser
Species Human (GRCh38)
Location 15:32889693-32889715
Sequence ACCCACGTGCTGGAGGTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124806561_1124806566 0 Left 1124806561 15:32889693-32889715 CCCCTAACCTCCAGCACGTGGGT 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1124806566 15:32889716-32889738 GTTTCTCCCCTGTTCTCCAAAGG 0: 1
1: 0
2: 0
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124806561 Original CRISPR ACCCACGTGCTGGAGGTTAG GGG (reversed) Intronic
903275148 1:22216877-22216899 ACCTTCTTGCTGGAGGTTGGCGG + Intergenic
912467816 1:109886163-109886185 CCTCACCTGCTGGAGGTGAGGGG + Intergenic
914259521 1:145987335-145987357 ACCCAGGTGCTGGAGTGCAGTGG + Intergenic
914818445 1:151080770-151080792 ACCCAGGAGGTGGAGGTTGGAGG + Intronic
917666253 1:177228619-177228641 ATACAGGTGCTGGAGGTTGGAGG + Intronic
919512862 1:198488245-198488267 ACCCAGGAGGTGGAGGTTACAGG + Intergenic
919777740 1:201205255-201205277 ACCCACCGGCTGGTGGTGAGGGG + Exonic
920501477 1:206488099-206488121 AACCACCAGCTGGAGGTTAGCGG - Intronic
921995665 1:221415191-221415213 ACCAACTTGCTGGAGGTCATGGG + Intergenic
1064006065 10:11700068-11700090 ACCCAGGCGCTGGAGTTCAGTGG - Intergenic
1068780973 10:60918821-60918843 ACCCAGGAGGTGGAGGTTTGTGG - Intronic
1069621480 10:69840228-69840250 GCCCAGGTGCTGGGGGTCAGGGG + Intronic
1073038496 10:100581303-100581325 AACCACCTGCTGGGAGTTAGCGG + Intergenic
1073597572 10:104816567-104816589 ACCCAAGTGCAGGAAGTTTGTGG + Intronic
1076231274 10:128821814-128821836 ACCCAGGAGGTGGAGGTTACAGG - Intergenic
1076699886 10:132265884-132265906 ACCCACATGCTAGGGGTTAGGGG + Intronic
1076884565 10:133255777-133255799 GCCCACATGCTGGGGGTCAGCGG + Intergenic
1078086240 11:8234455-8234477 GTCCACGTGCTGGAGCTGAGGGG - Intronic
1086912928 11:92493767-92493789 ACAGACGTGCTGAAGGCTAGTGG + Intronic
1090082991 11:123626758-123626780 GCCAACCTGCTGGAGGTTGGGGG - Intronic
1090927730 11:131263755-131263777 ACCCAGGCGCTGGAGTGTAGTGG - Intergenic
1092749736 12:11707637-11707659 ATCTACATGCAGGAGGTTAGAGG - Intronic
1099889615 12:88574706-88574728 ACACACGTACTGGAAGTTAAAGG + Intronic
1102269836 12:111523647-111523669 ACCCAGGAGGTGGAGGTTACAGG + Intronic
1102453121 12:113056127-113056149 ACCCACCTGCTCCAGGTGAGAGG - Intergenic
1102703421 12:114860306-114860328 GCCCAGGGGCTGGAGGTGAGAGG - Intergenic
1104118426 12:125773259-125773281 ACCGACGTGCTGGGTGTTGGTGG - Intergenic
1110211737 13:72981166-72981188 ACCCAGGAGGTGGAGGTTGGAGG + Intronic
1117840042 14:59850679-59850701 AACCACTTGAAGGAGGTTAGTGG + Intronic
1119201578 14:72756733-72756755 ACCCAGGAGGTGGAGGTTATAGG + Intronic
1119519935 14:75278121-75278143 GCCCGAGGGCTGGAGGTTAGGGG + Intergenic
1122434592 14:101686297-101686319 TCCCAGATGCTGGAGGTTGGGGG + Intergenic
1122947966 14:105021794-105021816 AGCCAAGTGCTGGAAGTTGGGGG + Intergenic
1124806561 15:32889693-32889715 ACCCACGTGCTGGAGGTTAGGGG - Intronic
1125425750 15:39547747-39547769 TTCCAGGGGCTGGAGGTTAGGGG + Intergenic
1133786950 16:8981365-8981387 ACCCATGAGCTGGAGGTTGCAGG + Intergenic
1135633299 16:24053134-24053156 AACCCCGTGCTGGATGTGAGGGG - Intronic
1140192889 16:72833288-72833310 ACACACGTGCTGGAGAATGGAGG + Intronic
1140694619 16:77520284-77520306 ACCCAGGTGCTGGAGTGCAGTGG - Intergenic
1141997715 16:87645822-87645844 AGCCACCTGCTGCAGGTTGGAGG + Intronic
1142669804 17:1482853-1482875 AACCCGGTGCTGGAGGTGAGGGG - Exonic
1143700592 17:8656977-8656999 GCCTAAGTGCTGGGGGTTAGAGG - Intergenic
1149725921 17:58894196-58894218 ACCCAGGAGCTGGAGGTTGCAGG - Intronic
1150410465 17:64937233-64937255 AAGAACGTGCTGGAGGTGAGTGG + Intergenic
1152393386 17:80016568-80016590 AGCCAAGTGCTGGAGGTGAAAGG - Intronic
1152686221 17:81695053-81695075 ACCAACGTGGTGGAGGTGAGGGG + Exonic
1155793072 18:29998035-29998057 TCCCACGAGCTAGAGTTTAGTGG - Intergenic
1156337941 18:36186829-36186851 ACCCACGTGCGGGAAGTGCGGGG + Intergenic
1157665222 18:49480276-49480298 ACCCAGGTGCTGGAGTGCAGCGG - Intronic
1158028675 18:52935652-52935674 ATCCATTTGCTTGAGGTTAGTGG + Intronic
1160039758 18:75335005-75335027 TCCCATGTCCTGGAGGTTACGGG + Intergenic
1161301311 19:3544353-3544375 ACCCCCAGGCTGGAGGTGAGGGG + Exonic
1161716561 19:5879450-5879472 ACCCAGGAGGTGGAGGTTGGAGG + Intronic
1163522404 19:17799343-17799365 ACCCAGGAGGTGGAGGTTACAGG - Intronic
1164245892 19:23428597-23428619 ACACACATGCTGGAGGGCAGGGG + Intergenic
1165019838 19:32914943-32914965 ACCCAGGAGGTGGAGGTTACAGG + Intronic
1165057270 19:33185712-33185734 ACCCACTTGCTGGAGCTCCGTGG - Intronic
1165473748 19:36017771-36017793 ACCCTCGTGCTGCAGGTTACTGG - Exonic
1165950645 19:39472479-39472501 ACCCCAGTGCTGGAGGTGAGAGG + Exonic
1166036848 19:40174661-40174683 ACCCAGGAGCTGGAGGTTGCAGG + Intergenic
1166050213 19:40254750-40254772 ACCCAGGAGGTGGAGGTTGGAGG + Intronic
927490353 2:23517160-23517182 ACCCCCGGGCTGGAGGAGAGTGG - Intronic
938070350 2:128305124-128305146 ACCCACTTGCTGAAGGATGGGGG + Intronic
940120876 2:150264312-150264334 ACCCAGGTGCTGGAGTGCAGTGG - Intergenic
942714479 2:178875486-178875508 ACCCAGGAGCTGGAGGTTAAAGG + Intronic
942860766 2:180608593-180608615 ACAGACGTGCTAGAGGTTAAAGG + Intergenic
948040803 2:234900195-234900217 TCCCAAGTGATGGGGGTTAGAGG + Intergenic
1171151303 20:22828535-22828557 ACCCACCTGCTAGAGATCAGTGG + Intergenic
1173453089 20:43182465-43182487 ACCCAGGTGGTGGAGGTTGCAGG - Intronic
1174023484 20:47551555-47551577 ACACACATCCTGGAGGTGAGGGG - Intronic
1175176357 20:57114793-57114815 AGCCAGGTGCAGGAGGTCAGGGG + Intergenic
1178089501 21:29146596-29146618 AGCCCCTTGCTGCAGGTTAGAGG - Intronic
1179897749 21:44372043-44372065 ACCCAGGAGCTGGAGGTTGCAGG + Intronic
1184335138 22:43848503-43848525 ACCCTCCTGCTCGAGGCTAGTGG - Intronic
1184463142 22:44651532-44651554 ACCCAGGAGGTGGAGGTTACAGG + Intergenic
1185137259 22:49080006-49080028 CCCCACGTGCTGCAGGTCCGAGG - Intergenic
950300398 3:11872390-11872412 AGCCACGTGTAGGTGGTTAGTGG + Intergenic
954362398 3:50128950-50128972 ACCCAGGAGGTGGAGGTTATAGG - Intergenic
957214420 3:77300943-77300965 ACCCAAGAGGTGGATGTTAGTGG - Intronic
957375863 3:79356299-79356321 ACACACAGGCTGGAGGGTAGTGG - Intronic
957385428 3:79490354-79490376 ATCCACCTACTGGAGGGTAGAGG - Intronic
961444355 3:126972255-126972277 ACCCCCGTGATGGAGGGTGGGGG + Intergenic
961592845 3:127993614-127993636 ACCCAGGTGCTGGAGTGCAGTGG - Intergenic
964485760 3:157183924-157183946 ACCCAGGTGCAGAAGGTGAGTGG - Intergenic
967322263 3:188206242-188206264 GCGCACCTGCTGGAGGTTCGAGG + Intronic
967775443 3:193381509-193381531 ATACACGTGCTGGAGGGTTGAGG + Intergenic
973557213 4:52096114-52096136 ACCCCTGTGCTGGAGGTTTGAGG + Exonic
977412514 4:96686071-96686093 ACCCAGGTGGTGGAGGTTGCAGG + Intergenic
981097634 4:140798110-140798132 ACCAACGAGCTGGAGGTTGTGGG + Intergenic
984968930 4:185168831-185168853 ACCCAGGAGCTGGAGGTTGTTGG + Intronic
989123198 5:38025345-38025367 ACACACGTGGAAGAGGTTAGCGG + Intergenic
990333041 5:54746036-54746058 ACCCAGGTACTGGAGCTCAGGGG - Intergenic
992419244 5:76585589-76585611 ACCCAGGAGGTGGAGGTTTGTGG - Intronic
997351315 5:133233416-133233438 ACCCACGTCCTGCAGGTGAATGG - Exonic
998571742 5:143265684-143265706 TGCCAGGTGCTGGGGGTTAGAGG - Intergenic
1001054281 5:168436334-168436356 ACCAACATGCTAGAGGTGAGGGG - Intronic
1001380622 5:171304268-171304290 ACCCTAGGGCTGGAGGTTAGAGG - Intergenic
1002380144 5:178821753-178821775 ACCCAGGAGGTGGAGGTTGGAGG - Intergenic
1004262212 6:14118080-14118102 ACCCACGGGCTGGGGTTTGGTGG + Intronic
1005950536 6:30627959-30627981 ACAAAAGTGCTGGAGGTTAGGGG + Intronic
1006619071 6:35349816-35349838 ACCCAGGAGGTGGAGGTTACAGG - Intronic
1011515117 6:88145203-88145225 GCCCACGTACAGGAGGTCAGTGG + Exonic
1016011246 6:139139495-139139517 ATACACGTGCTGGAGGTTACTGG + Intronic
1016404398 6:143715330-143715352 ACCTTCCTGCTGGGGGTTAGGGG - Intronic
1019714046 7:2530232-2530254 CCCCGGGTGCTGGAGGTCAGGGG + Intergenic
1019935187 7:4250418-4250440 ACCCAGGAGGCGGAGGTTAGAGG - Intronic
1024536463 7:50438857-50438879 ATGCACGTGTTGGAAGTTAGTGG + Intergenic
1025091592 7:56068741-56068763 ACCCAGGTGCTGGAGTGCAGTGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1034451002 7:151137281-151137303 CGCCAGGTGCTGGAGGTTAGTGG - Intronic
1039619349 8:38982302-38982324 ACCCAGGGGCTGGAGGTGGGAGG + Intronic
1049241876 8:141541902-141541924 TCCCACCTGCTGGAGGCTGGAGG + Intergenic
1056870281 9:90270995-90271017 AGCCACCTGCTGGAGGGTGGAGG - Intergenic
1057563654 9:96149121-96149143 GCCCACTTGCTGGAGATTACAGG - Intergenic
1058342519 9:103916360-103916382 TCCCAGGTGCTGGGGGTGAGTGG - Intergenic
1060348094 9:122834301-122834323 ACCCAGGAGGTGGATGTTAGAGG + Intergenic
1189457952 X:41211563-41211585 ACCCCCGTCCGGGAGGTGAGGGG + Intronic
1190461212 X:50677761-50677783 AGCCACGTCCTGGAGATTAATGG + Intronic