ID: 1124810512

View in Genome Browser
Species Human (GRCh38)
Location 15:32932817-32932839
Sequence TACAACCGATGCCACAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124810512 Original CRISPR TACAACCGATGCCACAGAAC TGG (reversed) Intronic
901869614 1:12130264-12130286 TACAACCCATTGAACAGAACAGG - Intronic
910236887 1:85046223-85046245 TACAAGCGATGCCACAGACTGGG - Intronic
913957095 1:143316874-143316896 TCCAGCCTAGGCCACAGAACAGG - Intergenic
914051409 1:144142238-144142260 TCCAGCCTAGGCCACAGAACAGG - Intergenic
914127788 1:144824303-144824325 TCCAGCCTAGGCCACAGAACAGG + Intergenic
915763006 1:158334421-158334443 TACAAACCATGCCATAGAGCTGG - Intergenic
920658686 1:207896948-207896970 TACATCCCATGCAACAGAAGAGG + Intronic
924366337 1:243297867-243297889 TACAAGCGAAGCCACAGAGTGGG - Intronic
1063865958 10:10365832-10365854 TACAACACATGCCACACAAAGGG + Intergenic
1065331482 10:24604880-24604902 GACAACTGTTGCCACTGAACAGG + Intronic
1065332958 10:24622732-24622754 TACAAAGGATGTCACAGCACTGG - Exonic
1066649059 10:37638670-37638692 AACACCAGATGGCACAGAACAGG + Intergenic
1066760552 10:38743745-38743767 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1068755079 10:60643654-60643676 TACAACCGCTGCCACAGTGATGG + Intronic
1071265929 10:83964977-83964999 TTCAACCGATGCCACAGAGGAGG + Intergenic
1088315633 11:108503726-108503748 TAAAAACCATGCCACAGAATTGG - Intergenic
1092237243 12:6818250-6818272 TAAAACCGATTCCCCAGCACTGG + Intronic
1099692412 12:85974901-85974923 TAGAAAAGATGCCAGAGAACCGG + Exonic
1100226014 12:92556357-92556379 TTCAAAGGATTCCACAGAACAGG - Intergenic
1102840845 12:116119407-116119429 TACAATCGGCGCTACAGAACTGG - Intronic
1121256381 14:92533000-92533022 TGCAACAGATGGCACAGGACTGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1202931260 14_KI270725v1_random:33174-33196 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1123421160 15:20138496-20138518 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1123443970 15:20308283-20308305 TGCAGCCTAGGCCACAGAACAGG + Intergenic
1123530385 15:21145032-21145054 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1124810512 15:32932817-32932839 TACAACCGATGCCACAGAACTGG - Intronic
1125081195 15:35675588-35675610 TATAACAGATGGCACAGAGCAGG + Intergenic
1132018579 15:98340351-98340373 TACAACCTGTGCCACAGTCCTGG + Intergenic
1133991100 16:10708177-10708199 TACGAACGATGTCACAGAAAAGG + Intergenic
1135145025 16:19953734-19953756 TCCAGCCTAGGCCACAGAACGGG - Intergenic
1136722235 16:32335561-32335583 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1136840552 16:33541540-33541562 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1139395289 16:66633922-66633944 TAGAACGGATCCCAAAGAACAGG + Intronic
1142064300 16:88051874-88051896 TGCAAACGATACCACAGAAATGG - Intronic
1203004196 16_KI270728v1_random:182203-182225 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1203135804 16_KI270728v1_random:1718610-1718632 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1203150719 16_KI270728v1_random:1841837-1841859 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1152962583 18:88693-88715 GACAACCGCTGCCCCAGCACTGG + Intergenic
1158680834 18:59565310-59565332 TCCAACCAATGGCACAGGACTGG + Intronic
1163956363 19:20645640-20645662 TACAACAGATGACACAGATAAGG - Intronic
1164291325 19:23871482-23871504 AACAACCCATGCAACAGCACAGG + Intergenic
1202690808 1_KI270712v1_random:94663-94685 TCCAGCCTAGGCCACAGAACAGG - Intergenic
925015593 2:522044-522066 CAGAACCGATGGCACCGAACCGG + Intergenic
929180072 2:39028675-39028697 TAAAACCTATTCCATAGAACAGG + Intronic
933283811 2:80362150-80362172 TCCTACCCCTGCCACAGAACTGG + Intronic
933955586 2:87359289-87359311 TCCAGCCTAGGCCACAGAACAGG + Intergenic
934239771 2:90255520-90255542 TCCAGCCTAGGCCACAGAACAGG + Intergenic
934273424 2:91561240-91561262 TCCAGCCTAGGCCACAGAACAGG - Intergenic
934323870 2:91988050-91988072 TCCAGCCTAGGCCACAGAACAGG + Intergenic
934462212 2:94218854-94218876 TCCAGCCTAGGCCACAGAACAGG + Intergenic
937207833 2:120247988-120248010 TGCAACCCATGCCTGAGAACAGG + Intronic
938332423 2:130457234-130457256 TAGAACAGAGGCCACAGAAATGG - Intergenic
938357384 2:130663434-130663456 TAGAACAGAGGCCACAGAAATGG + Intergenic
940912994 2:159225299-159225321 TACAGCAGATGACACAGCACAGG + Intronic
943623180 2:190172137-190172159 TATAGCCTATGCCAAAGAACAGG - Intronic
1171104163 20:22416534-22416556 TACATCCAATGACACACAACTGG - Intergenic
1173104042 20:40115118-40115140 TAAAACCAATGCCCCAGGACTGG + Intergenic
1175055941 20:56198206-56198228 AACAACCAAAGTCACAGAACAGG - Intergenic
1175354449 20:58352631-58352653 CACAACCGGTGACACACAACAGG - Intronic
1176593287 21:8661796-8661818 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1178779220 21:35584772-35584794 TACATCCCAAGCCCCAGAACGGG + Intronic
1180276133 22:10638923-10638945 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1180550641 22:16533893-16533915 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1181354024 22:22287910-22287932 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1182074447 22:27485800-27485822 TCCAACCAATGCCAGAGAAGAGG + Intergenic
949986176 3:9543101-9543123 TACAACTGATACCACAAAAAGGG + Intronic
951675870 3:25241148-25241170 TACAACTGATACCACAGAAATGG - Intronic
953303019 3:41797967-41797989 TACAACCCATGCTCCTGAACAGG + Intronic
960148329 3:114226783-114226805 TACAACCCATGCCAAAGACTTGG + Intergenic
960680998 3:120247474-120247496 TACAACAGATGCCACACAACTGG + Intronic
964878318 3:161394904-161394926 TCAAAACTATGCCACAGAACTGG - Intergenic
966801178 3:183765645-183765667 TAGAAACTATGCCAGAGAACAGG + Intronic
974885278 4:67810034-67810056 TACTACCCATGCCACCCAACTGG + Intergenic
980478186 4:133347887-133347909 TACAACCCATGCTACAGAAAAGG + Intergenic
981484624 4:145272031-145272053 TCCAACCTAGGCAACAGAACAGG - Intergenic
984093746 4:175408944-175408966 TACAACCCATGCTACAGATATGG - Intergenic
984443728 4:179806543-179806565 TACAACTGATACCACAGGGCGGG + Intergenic
994938103 5:106282766-106282788 GACAACAAATGCTACAGAACAGG + Intergenic
997965792 5:138354685-138354707 TACCACTGATCCCACGGAACTGG + Intronic
998001571 5:138630083-138630105 TGCACCTAATGCCACAGAACTGG + Intronic
999436592 5:151568103-151568125 TACCACCTATGCCACTGTACTGG - Exonic
1000983115 5:167838168-167838190 TACAACAGTAGCCACAGAAATGG + Intronic
1001595724 5:172897502-172897524 AGCAACCGATGCCACAGGCCTGG - Intronic
1005349796 6:24922828-24922850 TACAGCCTGTGCAACAGAACAGG + Intronic
1008200857 6:48587976-48587998 TACAAAAGATGCCAGAGAAATGG + Intergenic
1018649911 6:165985075-165985097 CACAGCCGAGGCCACAGAGCTGG + Intronic
1022520190 7:31001177-31001199 GATAACCGATTCCACAGACCGGG - Intergenic
1023324048 7:39032999-39033021 TACACTCGATGACACTGAACGGG - Intronic
1028481317 7:91309131-91309153 TAAAACTTATGCCAGAGAACAGG + Intergenic
1033289887 7:140074641-140074663 CACAACGGCTGCCAAAGAACAGG - Intergenic
1034030700 7:147759900-147759922 TAAAAAGGATGCCACAGAAAAGG + Intronic
1037979896 8:23245675-23245697 TAAAAGAGATGGCACAGAACTGG + Intronic
1038177768 8:25196832-25196854 TACAACTCATTCCAAAGAACTGG - Intronic
1039265218 8:35816368-35816390 TACATCCCATGCCACCTAACTGG + Intergenic
1042149056 8:65761940-65761962 CACAACCGATGTCACAAAAGAGG + Intronic
1043997894 8:86842335-86842357 CACAACCACTGCCACAGAATGGG - Intergenic
1052789638 9:32863160-32863182 TACAACACTTGCCACAGAAGAGG + Intergenic
1053692692 9:40594526-40594548 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1054272124 9:63042988-63043010 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1054303934 9:63395448-63395470 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1054402712 9:64721954-64721976 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1054436324 9:65206316-65206338 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1054494070 9:65815394-65815416 TCCAGCCTAGGCCACAGAACAGG - Intergenic
1060008065 9:120018048-120018070 TGCTACCGATGCCCCTGAACTGG + Intergenic
1062735555 9:138135423-138135445 GACAACCGCTGCCCCAGCACTGG - Intergenic
1203623328 Un_KI270749v1:140603-140625 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1186893911 X:13987370-13987392 TAGACCCAATGCCACAGAAAAGG - Intergenic
1188108132 X:26166957-26166979 TACAACTGATGCTGCAGAAATGG - Intergenic
1201191256 Y:11442968-11442990 TCCAGCCTAGGCCACAGAACAGG + Intergenic
1202256194 Y:22923093-22923115 CACAACCGATCCCACAGAAATGG + Intergenic
1202409185 Y:24556846-24556868 CACAACCGATCCCACAGAAATGG + Intergenic
1202461597 Y:25113232-25113254 CACAACCGATCCCACAGAAATGG - Intergenic