ID: 1124811451

View in Genome Browser
Species Human (GRCh38)
Location 15:32943195-32943217
Sequence AAATATCCACATAGGGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124811446_1124811451 11 Left 1124811446 15:32943161-32943183 CCATTTCAGATAAGGGATACTCG 0: 1
1: 4
2: 13
3: 24
4: 86
Right 1124811451 15:32943195-32943217 AAATATCCACATAGGGTACACGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124811451 Original CRISPR AAATATCCACATAGGGTACA CGG Intronic
905047190 1:35014851-35014873 AAATATCAAAATGTGGTACATGG - Exonic
906252303 1:44319934-44319956 TAATATCCTCATAGGTTCCAGGG + Intronic
912560897 1:110550856-110550878 CAATATCCACACTGTGTACAAGG - Intergenic
913484505 1:119321684-119321706 AAATATCTACAGAGAGTAGATGG + Intergenic
916416471 1:164597012-164597034 AAATAAAGACAGAGGGTACAGGG - Intronic
916465883 1:165074393-165074415 GAATACCCCCATAGGGTAGAAGG - Intergenic
916515730 1:165514779-165514801 AAATATCTACATAGTGTATTTGG - Intergenic
918823149 1:189285440-189285462 AAATATCCACATAAGGTTTGGGG + Intergenic
920224149 1:204425696-204425718 AAATTTTCACATAGGGGTCAGGG + Exonic
922972866 1:229757915-229757937 AAATCTCCAGAAAAGGTACAGGG - Intergenic
923032132 1:230257553-230257575 TAATATACACCTAGGCTACATGG - Intronic
923749266 1:236732390-236732412 AAATATTCACAGAGGGGAAAAGG - Intronic
1070714791 10:78711596-78711618 AAATGTCCACCTTGGGTAAAGGG - Intergenic
1072645740 10:97251846-97251868 AAATATCCAGAAAGGGCACCAGG + Intronic
1078113144 11:8416793-8416815 AAATTTCCACATAGGAAATAGGG - Intronic
1079764634 11:24376253-24376275 AATTATCCACATAGACTACATGG + Intergenic
1081290485 11:41319356-41319378 TAATATCCACATCTGTTACATGG + Intronic
1081922499 11:46791830-46791852 AAATATCCAAAATAGGTACAAGG - Intronic
1082085551 11:48046727-48046749 AATAATCCACATAGGGTAGGGGG - Intronic
1084615426 11:70232513-70232535 AAAAAACGACAGAGGGTACATGG - Intergenic
1086032184 11:82373428-82373450 CAATATCAACATAAGCTACATGG + Intergenic
1086075773 11:82850324-82850346 AAATATCCTCATATGGTAGTTGG - Exonic
1086267425 11:85017929-85017951 AAAAAACCACATAAGGAACACGG + Intronic
1087256457 11:95960339-95960361 AAAAATCCATATAGGTTAAAAGG + Intergenic
1087511797 11:99103792-99103814 AAAGAGACACATAGGGGACAAGG + Intronic
1088114235 11:106297820-106297842 AAATATCCAAACAAGCTACATGG - Intergenic
1089335835 11:117723404-117723426 AAATATCCAGCTTGTGTACAAGG + Intronic
1092252312 12:6906445-6906467 AAATATCCACATAGCGCAGATGG - Exonic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1095765243 12:45887062-45887084 AAATATTCACATAGGCTACTAGG - Intronic
1099834016 12:87883828-87883850 AAATATCCTCATATGGCATATGG - Intergenic
1100071497 12:90725179-90725201 AAATATCCACATGTGGTTAAAGG + Intergenic
1100127360 12:91444114-91444136 AAATATCTAGATGGGGAACAAGG + Intergenic
1100140693 12:91615297-91615319 ATATATCAACATATGGAACATGG - Intergenic
1102349346 12:112180628-112180650 AACTTTCCACATATGGTACCTGG - Intronic
1103001798 12:117390430-117390452 AAATAACCACATAGGTTTTAAGG - Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1110306658 13:73995768-73995790 ATATATCCAAATAGGGCAAATGG - Intronic
1111624471 13:90766533-90766555 AAATATACACATACTGAACAAGG + Intergenic
1117692944 14:58327094-58327116 AAATGGCCACATATGGTTCATGG - Intronic
1118432057 14:65728780-65728802 ATATATCCACCTAGGCTATATGG - Intronic
1119961471 14:78862388-78862410 AAATATCCACATAGCTTTAAGGG + Intronic
1124811451 15:32943195-32943217 AAATATCCACATAGGGTACACGG + Intronic
1125474530 15:40038165-40038187 AAATAGCCACACAGGGCAAAAGG + Intronic
1127205900 15:56718608-56718630 AAATTTTCACACAGGGTACAGGG + Intronic
1130239204 15:82170044-82170066 AAATAACCACACAGAGGACATGG + Intronic
1130394533 15:83490497-83490519 AAATATCCACCAAGGGCAGAGGG + Intronic
1131761821 15:95631726-95631748 AAATTTTCCCACAGGGTACATGG - Intergenic
1131909598 15:97182960-97182982 AAACATCCACATAGAGTAAATGG + Intergenic
1138768256 16:59630533-59630555 AAAAACCCACATTGGCTACATGG - Intergenic
1146611396 17:34308258-34308280 AAATATCTAAATAGGTTCCATGG + Intergenic
1149367695 17:55962378-55962400 AAACATCCACATAGGTTCCTAGG + Intergenic
1156218982 18:35032161-35032183 AAATATACACATGGGGGAAATGG + Intronic
1156506271 18:37596427-37596449 AAAAAGCCACAGAGGGTAAAGGG - Intergenic
1157227712 18:45882370-45882392 AAATATCCTCATCTGGTTCAAGG + Exonic
1158699102 18:59730589-59730611 AAATGACCACCTAGGGTCCAAGG + Intergenic
1158913154 18:62088737-62088759 AAGTCTCCACAAAGGATACAAGG + Exonic
1159124214 18:64204419-64204441 AAATATCCACTTAGAGTATAAGG + Intergenic
1165527345 19:36367419-36367441 AGATAGCCACATAGGATACTGGG + Intronic
1165551280 19:36588509-36588531 AAACATACACTTAGGGAACAGGG - Intronic
925952258 2:8926391-8926413 AAAACTCAACATAGAGTACAAGG + Intronic
930519856 2:52451847-52451869 AAAAATACACAAAGGGTATATGG - Intergenic
932781764 2:74563070-74563092 GAATGTCCAGAGAGGGTACAAGG + Intronic
933211506 2:79575235-79575257 AAATATCCACACTGGTTATAGGG + Intronic
935358628 2:102228270-102228292 AAATATCCTCAAGGGGAACAAGG - Intronic
935917807 2:107975553-107975575 AAATATACACAAAGGGTTTAAGG + Intergenic
940319342 2:152359301-152359323 AAATTTCCTCTTAGGTTACATGG - Intronic
940838640 2:158553855-158553877 AAACATCCAAATCAGGTACAGGG - Intronic
942361336 2:175175010-175175032 AAACATGCACATAGACTACATGG - Intergenic
943324397 2:186480605-186480627 ATATATCCAAAAAGGGAACAAGG + Intergenic
943634795 2:190294254-190294276 AAATGTCCAGTTAGGGTATATGG - Intronic
945365661 2:208950114-208950136 GAATATCCTCATAAGGTAGATGG - Intergenic
946610842 2:221455868-221455890 AATTATCCAGCAAGGGTACAAGG - Intronic
1168797899 20:623800-623822 AAATATACACAAAAGGCACAGGG - Intergenic
1170046716 20:12093375-12093397 ACATATTCACATACGCTACAAGG - Intergenic
1171120292 20:22562691-22562713 AAATATCCACCTATGTCACAGGG + Intergenic
1171536120 20:25891906-25891928 AAATATCAACATAGCTTACAGGG + Intergenic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1177245393 21:18516369-18516391 AAAGATCCCCTAAGGGTACAGGG + Intergenic
1177476090 21:21625581-21625603 TAATATCCACAAAGGGTGTAAGG - Intergenic
1178266753 21:31150030-31150052 ACATATACACATAGGAGACAGGG + Intronic
1181904148 22:26179892-26179914 AAATATCTACATGTGGTTCATGG - Intronic
949132180 3:516788-516810 ATATATCCACTCATGGTACATGG - Intergenic
950072333 3:10162935-10162957 AAATAAACAAAGAGGGTACAAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953600616 3:44360194-44360216 AAATAAGGAAATAGGGTACATGG - Intronic
956105751 3:65816417-65816439 AAATAGCCACATGGGGTAGTGGG + Intronic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
957781496 3:84823174-84823196 AAATATAAACATTGGGTAAAAGG - Intergenic
958021594 3:88004012-88004034 ATATAGCCACATAGGATATAGGG + Intergenic
959128003 3:102314424-102314446 ACACACACACATAGGGTACATGG - Intronic
960007624 3:112796454-112796476 AATTATCCACACAGGATAGATGG + Intronic
963707798 3:148709960-148709982 AAATAGCCACATATAGTAAATGG - Intronic
965935697 3:174108012-174108034 AAATATAAAAATATGGTACAAGG - Intronic
967685888 3:192415626-192415648 TGATATCCTCAGAGGGTACATGG + Intronic
967860739 3:194149488-194149510 AAATATCCACATTTGATATAAGG - Intergenic
967932107 3:194697397-194697419 CGATATCCACATGGGCTACATGG + Intergenic
970005901 4:11410454-11410476 AAAAAGCCAAATGGGGTACAAGG + Intronic
973664927 4:53149524-53149546 AAGTATCTACATAGGTTACTTGG - Intronic
973868839 4:55144014-55144036 AAATATTCCCCTAGGGTATAAGG - Intergenic
975646396 4:76550215-76550237 AAATATCAACAAAGGAAACACGG - Intronic
978922820 4:114205041-114205063 AAATATAAATATGGGGTACATGG - Intergenic
979194370 4:117902758-117902780 CCATATCAACATAGGATACAAGG + Intergenic
980471148 4:133253509-133253531 AAATATACACTTAAGTTACAGGG + Intergenic
980802047 4:137764398-137764420 TACTATACACATAGGCTACATGG - Intergenic
981244480 4:142517903-142517925 AAATATCAAGATATGGTAAAAGG - Intronic
982199385 4:152945324-152945346 AAAAATCTGCATAGGGTGCAGGG - Intronic
982275273 4:153631399-153631421 AAATATCCCCATGGGGCTCAGGG - Intronic
983816277 4:172130888-172130910 AAAAACTCACATAGGCTACAAGG - Intronic
988459892 5:31425504-31425526 AAATGTCCACTTAGGGTGAAAGG - Intronic
988943994 5:36176050-36176072 AAATATCTACCTGTGGTACATGG + Intronic
990696090 5:58419357-58419379 AAATAACTACAAAGGGTACCTGG - Intergenic
992656474 5:78915056-78915078 AAATACACACATAAGGAACAAGG - Intronic
993172944 5:84443987-84444009 AACTATACAAATAGTGTACAAGG + Intergenic
993928863 5:93911400-93911422 AGATATTCACATATGTTACATGG + Intronic
996927025 5:128839878-128839900 AAATATTCACAAATGGTAGAGGG + Intronic
1005217860 6:23553201-23553223 AAATATGAACAAAGTGTACAGGG - Intergenic
1006274035 6:32986845-32986867 AAATATTCACTTACTGTACAAGG - Intergenic
1006763645 6:36485785-36485807 AAAGATCCACATAGGGGGCCAGG - Intronic
1007220971 6:40278571-40278593 AAATAGACACATAGGGAACACGG + Intergenic
1016049679 6:139517985-139518007 CTATAGCCACATTGGGTACACGG + Intergenic
1018079567 6:160247289-160247311 AGGTATGCACCTAGGGTACAAGG + Exonic
1019829773 7:3316194-3316216 AAATGTCATTATAGGGTACATGG - Intronic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1022196540 7:28073194-28073216 TAATATCTAGATAGGTTACAGGG + Intronic
1022772365 7:33487671-33487693 AAATGTGAGCATAGGGTACAAGG - Intronic
1028988927 7:97028687-97028709 AGATCTCCAGATAGGCTACATGG - Intergenic
1033094783 7:138420895-138420917 AAATATCCAGACAGTGTTCAAGG + Intergenic
1033585177 7:142769521-142769543 AAATACCAAAATAGGGTCCATGG - Intergenic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1037848366 8:22305077-22305099 AAATATCCACATAAGCTATTAGG + Intronic
1038108838 8:24470431-24470453 AAATATCCCAAAAGGGTAGAGGG + Intronic
1039460539 8:37740115-37740137 AAATAGGCACATAGGCTAAATGG - Intronic
1041546455 8:59048763-59048785 TAATATTCACATCGGGTAAATGG + Intronic
1042669906 8:71250058-71250080 AAATATCCACAAAAGACACAAGG - Intronic
1042808443 8:72797699-72797721 AATTATCCACATCGCTTACAGGG + Intronic
1042813249 8:72849232-72849254 AATTGTACATATAGGGTACATGG + Intronic
1044263916 8:90160656-90160678 ATAAATCCACACAGGGTTCAAGG - Intergenic
1044503264 8:92987917-92987939 ACAGATGCAGATAGGGTACATGG + Intronic
1045184371 8:99821771-99821793 AAATATCCACAAATTGTACTTGG + Intronic
1045788200 8:105950012-105950034 GAATATCAACAGAGGGTTCAAGG - Intergenic
1046518669 8:115296488-115296510 AAATTTCCACATATTTTACACGG - Intergenic
1046732032 8:117736234-117736256 AAATATGCACACAGGGGACAGGG + Intergenic
1047567187 8:126058206-126058228 AAATATACACATAAGTTCCAGGG - Intergenic
1048118924 8:131556580-131556602 AAATAACTAAATAGGGTACAAGG + Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1052646225 9:31237470-31237492 TAATGTCCACACAGAGTACAGGG - Intergenic
1055877640 9:80962404-80962426 AAATTTACAAATAGGGTAGAGGG - Intergenic
1056153397 9:83810898-83810920 TACTATCCACCTAGGCTACATGG + Intronic
1056357239 9:85813516-85813538 TACTATCCACCTAGGCTACATGG - Intergenic
1056749138 9:89333748-89333770 AAATATCAAAGCAGGGTACATGG - Intronic
1058865972 9:109162744-109162766 ATATATCCACATACCGTCCAAGG + Intronic
1058993854 9:110280484-110280506 AAATAGGCAAATAGGGTACAGGG + Intergenic
1059806178 9:117802938-117802960 AAATATCTTCATAGGCGACACGG + Intergenic
1186395493 X:9204875-9204897 AAATATACACGTAGAGTGCAAGG + Intergenic
1186660395 X:11663917-11663939 AAATATCAACATTGGGTGAAGGG + Intronic
1188250957 X:27893734-27893756 AAATATCCACATAGCCATCATGG + Intergenic
1191898252 X:66015846-66015868 AAAGATACACATTGGGTAAATGG - Intergenic
1197250783 X:124214506-124214528 AAATATCCATCTAGGGTCAATGG + Intronic
1199511318 X:148626220-148626242 AAATAACCACAAAGAGTAAATGG - Intronic
1201502260 Y:14658029-14658051 AAATATGCAGATATGTTACAAGG + Intronic