ID: 1124812116

View in Genome Browser
Species Human (GRCh38)
Location 15:32951609-32951631
Sequence TCATTGCCACCATGAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124812116_1124812121 25 Left 1124812116 15:32951609-32951631 CCCAGTTCTCATGGTGGCAATGA 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1124812121 15:32951657-32951679 CCATTGATGTGCCAAGCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124812116 Original CRISPR TCATTGCCACCATGAGAACT GGG (reversed) Intronic
904496113 1:30887667-30887689 TCACTGCCACCAGGAGCAATTGG - Intronic
906022538 1:42642838-42642860 TCATTGCCTCACTGAGGACTTGG + Intronic
908444925 1:64191278-64191300 ACAAAGCCACCATCAGAACTGGG - Intergenic
908840561 1:68276262-68276284 CCAATGCCACCATGAGATTTGGG - Intergenic
909923205 1:81407109-81407131 TCATTGCTACCATCTGTACTTGG + Intronic
913425056 1:118719392-118719414 TCATTGCCAACATTAGATGTAGG - Intergenic
921069407 1:211646399-211646421 CCATTGCCACCTTGAGATCAGGG + Intergenic
921982461 1:221273504-221273526 TGATTGTCACCATTAGGACTTGG - Intergenic
923537465 1:234864068-234864090 TCATTGCCTCTCTGAGACCTGGG + Intergenic
923818738 1:237410712-237410734 TCATTGCCACCATGAAAGGGTGG - Intronic
924558137 1:245134677-245134699 TCATTGCTAACAGGAGATCTGGG - Intergenic
1063303434 10:4874687-4874709 TCAGTGCTACCAAGAGAAATGGG + Intergenic
1064391392 10:14945449-14945471 TCAGTGCCACCAAGAGCACAAGG + Intronic
1065263666 10:23952863-23952885 TCATTTCAAGCATGAGGACTTGG + Intronic
1065634121 10:27712860-27712882 TCACTGCCACCTTGAGCTCTGGG - Intronic
1067473119 10:46550132-46550154 TCAGTGCCACCACTAGACCTGGG - Exonic
1071261021 10:83918994-83919016 ACATGGCCACCATGAGAAGACGG + Intergenic
1072230338 10:93409080-93409102 TCATTCCCAAGATGGGAACTGGG + Intronic
1072917368 10:99546769-99546791 TCAGTGCCTGCATGAGGACTGGG - Intergenic
1074031789 10:109696539-109696561 TTATTGCCACAATCTGAACTGGG - Intergenic
1074772890 10:116744735-116744757 CAAGGGCCACCATGAGAACTAGG - Intergenic
1076512234 10:131021051-131021073 TCTCTGCCACCCTGGGAACTGGG - Intergenic
1079530092 11:21441632-21441654 TCATTGCCACCCTAAGAAGCAGG - Intronic
1085740091 11:79070949-79070971 TCAGTGCCACCGTCAGCACTGGG + Intronic
1087058422 11:93955697-93955719 TCCTCACCATCATGAGAACTGGG - Intergenic
1089398516 11:118151317-118151339 CCATTGCCACCATGGGGACCTGG + Intronic
1090469864 11:126970771-126970793 ACATTGCTTCCATGAGAACAAGG + Intronic
1090978471 11:131695665-131695687 GCATGCCCACCTTGAGAACTAGG + Intronic
1091214099 11:133889839-133889861 TCAGTGCCACCATGAAATATTGG - Intergenic
1091520921 12:1241695-1241717 TAAGTGCTACCAGGAGAACTGGG - Intronic
1092329793 12:7574290-7574312 TTCTTGCAACCATGAGAACTTGG + Intergenic
1093316968 12:17664369-17664391 TGAAGGCCACCATTAGAACTTGG + Intergenic
1097778773 12:63679505-63679527 TCATTTCAGCCATGAGCACTTGG - Intergenic
1099635780 12:85209297-85209319 TCACTGCCACCATGTGAAGAGGG - Intronic
1102523637 12:113495034-113495056 TCAGGGACACCATGAGAACAAGG - Intergenic
1104067342 12:125316812-125316834 TACAGGCCACCATGAGAACTTGG + Intronic
1104364386 12:128163855-128163877 TCATTGTTACCATATGAACTGGG + Intergenic
1105614972 13:22003426-22003448 TGAATGCCACCATGTGAACTGGG + Intergenic
1105841805 13:24260177-24260199 TCATTTCCTCCATGAGGGCTTGG - Intronic
1105990819 13:25618905-25618927 TCATTGCCAGTCTGAGAACTGGG - Intronic
1107557376 13:41528553-41528575 GCATTGAAACCATGAGAACAGGG + Intergenic
1109307522 13:60657211-60657233 TCATTCCCACCATGTAAACATGG + Intergenic
1110046179 13:70834350-70834372 TAATTGACACCATGAGCAATGGG - Intergenic
1110933824 13:81257732-81257754 TCATTGCAACCTTGAACACTTGG - Intergenic
1111886343 13:94026778-94026800 TCACTGCCACCATGTGAAGAAGG - Intronic
1114060571 14:19013151-19013173 GGATTGCCACCCTGGGAACTCGG - Intergenic
1114101685 14:19386827-19386849 GGATTGCCACCCTGGGAACTCGG + Intergenic
1115838061 14:37432827-37432849 TCATTGCCAAAATGAGATCTAGG + Intronic
1124812116 15:32951609-32951631 TCATTGCCACCATGAGAACTGGG - Intronic
1128717046 15:69916374-69916396 TCATTGACACCCTGAGACCGAGG - Intergenic
1129486224 15:75875202-75875224 TCATAGCCACCGTGTGAAATAGG + Intronic
1131360605 15:91787428-91787450 TCATGGCAACCAGGTGAACTGGG - Intergenic
1131730791 15:95278475-95278497 CCATTGCCATCCTGAGAACCTGG - Intergenic
1136527381 16:30840762-30840784 TTATTCCCACCATGTGAACAAGG - Intronic
1144441762 17:15289452-15289474 CCCTTGCCGCCATGACAACTTGG + Intergenic
1146442081 17:32906093-32906115 TCATAGAAACCATGAGTACTGGG + Intergenic
1155488597 18:26373970-26373992 TCATGGCCACCATGCTAACAAGG - Intronic
1157300577 18:46476234-46476256 TCTTTGCAACTGTGAGAACTTGG - Intergenic
1157553556 18:48597889-48597911 TCTTTTCCAGCCTGAGAACTTGG + Intronic
1158506367 18:58049617-58049639 TAAATGTCACCATGAAAACTAGG - Intronic
1158859016 18:61573922-61573944 TCACTGCCACCATGTGAAGAAGG - Intergenic
1161339247 19:3731764-3731786 TCATTGACACAATCAGATCTCGG + Intronic
1161985383 19:7650597-7650619 TCACTGCCAACATGAGACATGGG - Intergenic
1162922256 19:13910064-13910086 TCATTGGCTCCAGGAGAACAGGG - Intronic
1165710703 19:38008871-38008893 TCAAAGCCACCTTGAGAGCTAGG + Intronic
1166558082 19:43714897-43714919 TCAGAGCCACCCTGAGAGCTGGG - Intergenic
1168138517 19:54368311-54368333 TCCTTGCAACCATGAGAAGTTGG - Intronic
1168159448 19:54499692-54499714 TCCTTGCAACCACGAGAAGTTGG + Intronic
926459541 2:13111612-13111634 TTCTTGCCACCATGTGAAGTAGG + Intergenic
929841971 2:45476173-45476195 GCTTTGCTACCATGAGATCTTGG + Intronic
931161201 2:59692395-59692417 TCATTGCAGCCCTGAGAACTTGG - Intergenic
931518490 2:63069855-63069877 TAATGGCCACCATGAAGACTAGG - Intergenic
932923913 2:75948051-75948073 GCATCAGCACCATGAGAACTAGG + Intergenic
935345513 2:102104178-102104200 TGGTGGCCACCATGAGAAGTGGG + Intronic
935429555 2:102960523-102960545 TCTTCGCCACCATTTGAACTGGG - Intergenic
937118751 2:119427729-119427751 TCATGGGCTCCATGAGAGCTGGG - Intergenic
937425958 2:121798572-121798594 ACATTGCAACCATGAGCTCTGGG - Intergenic
940533436 2:154908269-154908291 TCATTACCAGCATCTGAACTTGG - Intergenic
941790373 2:169546132-169546154 TCATAGGCACTTTGAGAACTTGG - Intronic
942687178 2:178545597-178545619 TCATTGCCACCATCAGATTCAGG + Exonic
942727763 2:179028107-179028129 TCAATTCCACTATGAGCACTGGG + Intronic
942849175 2:180462489-180462511 TCATTAAAACCAAGAGAACTTGG - Intergenic
944526489 2:200624978-200625000 TCAGTGTCTCCAGGAGAACTGGG + Intronic
944742713 2:202627931-202627953 TCATTGCCTCCATCAGCACAAGG - Intergenic
944960019 2:204862188-204862210 TCATTGCCAAAATGAGGACAAGG - Intronic
947285179 2:228506270-228506292 TGGTTGCCACCATGAGTACTTGG + Intergenic
1168980046 20:1996356-1996378 TCATTGCCACCCTGGGAATCTGG + Intergenic
1171385621 20:24767733-24767755 TCCTTGACACCATGAAAGCTGGG - Intergenic
1172946962 20:38697140-38697162 TGAATGCCCCCAGGAGAACTTGG - Intergenic
1173047518 20:39526726-39526748 TCATTGCCATCTTCATAACTAGG + Intergenic
1173109494 20:40173467-40173489 TCATGGCCAGATTGAGAACTAGG - Intergenic
1174098109 20:48105643-48105665 ACACTGCCCCCATGAGAAATGGG + Intergenic
1177035284 21:16035151-16035173 TCATAGCCTCCTGGAGAACTAGG + Intergenic
1177459095 21:21386979-21387001 TCATTGTCCCAGTGAGAACTGGG - Intronic
1180023218 21:45142608-45142630 ACATGGCCACCATGTGACCTTGG + Intronic
1180479053 22:15735763-15735785 GGATTGCCACCCTGGGAACTCGG - Intergenic
1181885827 22:26021794-26021816 TCATAGCCACCCTGAGAGATAGG - Intronic
1182382537 22:29904245-29904267 TCATTGCTACCTTGTGAAGTAGG + Intronic
1183752774 22:39731513-39731535 TCATTGCCCCCTGGAGAGCTAGG - Intergenic
951032154 3:17894981-17895003 TCATTGCCACCATGAAAGGAAGG - Intronic
951997167 3:28744056-28744078 TCATTTCCTCCCTGGGAACTTGG + Intergenic
952226894 3:31386813-31386835 TCATTGTCACCAAAAGAAATGGG + Intergenic
953370117 3:42380436-42380458 CCATTTTCACCAAGAGAACTTGG - Intergenic
955366374 3:58313748-58313770 TCATTGCAACCTTGAGCTCTTGG - Intronic
956298847 3:67746528-67746550 TTGTTGCCACTATGAGAACATGG + Intergenic
958485589 3:94703580-94703602 TGATGGCCACCATGAGACTTTGG - Intergenic
958999930 3:100951744-100951766 TCATTACCATCCTGAGAACTTGG + Intronic
959806862 3:110564716-110564738 ACATTGATACCATGAGAACATGG + Intergenic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
966464276 3:180212650-180212672 TCACTGCCACCAAGAAGACTGGG + Intergenic
967231061 3:187337824-187337846 TCAGTGCCAACATGAGGAATGGG + Intergenic
969292797 4:6251585-6251607 TCACTGCCACCAGGTGACCTTGG + Intergenic
970144487 4:13020747-13020769 TTACTGCAACCATGAGTACTGGG - Intergenic
970661035 4:18286126-18286148 TGATCTTCACCATGAGAACTTGG + Intergenic
972119896 4:35687715-35687737 ACTTTGCCACCATCAAAACTAGG + Intergenic
973190584 4:47381054-47381076 TAATTGCCACCAGGAGAGCAGGG + Intronic
974403915 4:61440786-61440808 TCATTACCACCATTACTACTAGG - Intronic
978754549 4:112287647-112287669 TCATTTCCATCATCAGAATTTGG - Intronic
980161532 4:129169302-129169324 TAATTACCACCATGAAAAATTGG - Intergenic
981573127 4:146175151-146175173 TCAGTGCTACTATGGGAACTTGG - Intergenic
982969541 4:161966070-161966092 TTATTGCCACAAAGACAACTTGG + Intronic
985315498 4:188654904-188654926 TCATTTCCTCCGTAAGAACTTGG - Intergenic
985393899 4:189520967-189520989 TCATTTCCATAAAGAGAACTAGG - Intergenic
986207725 5:5641287-5641309 TAATAGCCACCTTGAGTACTTGG + Intergenic
987022094 5:13885070-13885092 TCATTTCAACCATCAGAACATGG - Exonic
988196199 5:28009218-28009240 TCATTGCCATCATGAGTACTTGG + Intergenic
988450155 5:31333936-31333958 TTATTGGCAGCATGAGAACAGGG + Intergenic
992905294 5:81339475-81339497 TAATTTCCACCAGGAGAACTTGG + Intronic
1002866458 6:1126261-1126283 TCATTTCCACCCTGAGGACATGG + Intergenic
1003221267 6:4163046-4163068 TCATTCCCACCATCAGGACTGGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1008665696 6:53713730-53713752 TCATTACCACCATGCGAAACTGG + Intergenic
1010088770 6:71953363-71953385 TATTTCCCACCATGTGAACTGGG - Intronic
1015995911 6:138995103-138995125 TCCTTGCCACCATGTGAAGAAGG + Intergenic
1017994239 6:159518303-159518325 ACATTGCAACTAAGAGAACTAGG - Intergenic
1018441520 6:163818101-163818123 TCATTGCCACAATGAAAATGTGG + Intergenic
1019525411 7:1478403-1478425 TCATCGCCACCCTGAGGTCTGGG - Exonic
1022130058 7:27396797-27396819 TCATTTCCACCATGTGGTCTTGG - Intergenic
1022937705 7:35197168-35197190 TCATTTCAGCCATGAGCACTTGG - Intergenic
1024785730 7:52905180-52905202 ACATACACACCATGAGAACTAGG - Intergenic
1028372424 7:90108424-90108446 TCATTTCAGCCATGAGCACTTGG + Intergenic
1028774719 7:94663997-94664019 TCATTTCCATCATGAAAGCTGGG - Exonic
1030887508 7:114956455-114956477 TTATTGCCTCCTGGAGAACTTGG + Intronic
1032576114 7:133056810-133056832 CCATGGCAACCATGAGAAATTGG + Intronic
1033051128 7:138005394-138005416 TGAATGGGACCATGAGAACTTGG - Intronic
1033952623 7:146803927-146803949 TCATTGCTAGAATGAGAAATAGG + Intronic
1037245120 8:16825457-16825479 TCATTGACATCATGGGATCTTGG - Intergenic
1037605765 8:20435865-20435887 TCAGTGCCACCTTGAGAAACAGG - Intergenic
1037737199 8:21577397-21577419 TCATTGCCACCACAAGAACTGGG + Intergenic
1047223458 8:122937517-122937539 TTATCCCCACCAGGAGAACTTGG - Intronic
1049574282 8:143383288-143383310 TTAGGGCCACCATGAGACCTGGG - Exonic
1050396722 9:5205637-5205659 TCATTGCCATCATGGGAAGAAGG + Intergenic
1051323883 9:15943199-15943221 ACACTGCCACCATGCGAACTAGG - Intronic
1056543350 9:87593051-87593073 TCACTGCCTCCCTGAGACCTGGG + Intronic
1058420656 9:104830115-104830137 TAGTTCCCACAATGAGAACTTGG + Intronic
1061069065 9:128297512-128297534 TCATGGCCACCCTGAGAGGTAGG + Intergenic
1062064766 9:134520502-134520524 TCAGTGACACCATGAGGTCTAGG - Intergenic
1186075113 X:5870100-5870122 TTCTTGCCACCATGAGAAGAAGG - Intronic
1187469377 X:19555036-19555058 TCAAAACCACCATGAAAACTGGG - Intronic
1193922896 X:87450507-87450529 TAATTTTCACCATGAGAACCTGG + Intergenic
1194891604 X:99385294-99385316 CCACTGCCATCATGAGTACTAGG + Intergenic
1197881135 X:131167915-131167937 TTATTGCAACAATGAGAACTGGG - Intergenic
1198007258 X:132508106-132508128 CCATTACCACCATGTGACCTTGG - Intergenic
1198414190 X:136403248-136403270 TGATTGCCACCATGATAGCCGGG - Exonic
1201641670 Y:16185086-16185108 TCATTTCCACCCTATGAACTAGG + Intergenic
1201661145 Y:16400238-16400260 TCATTTCCACCCTATGAACTAGG - Intergenic
1201683089 Y:16670579-16670601 TCACTGCCACCATGTGAAGAAGG - Intergenic