ID: 1124812178

View in Genome Browser
Species Human (GRCh38)
Location 15:32952100-32952122
Sequence TTCAGTTGCCACTGCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124812178_1124812184 -5 Left 1124812178 15:32952100-32952122 CCTTTCCTGCAGTGGCAACTGAA 0: 1
1: 0
2: 0
3: 21
4: 192
Right 1124812184 15:32952118-32952140 CTGAATGGCTGGGTTTTATAGGG 0: 1
1: 0
2: 1
3: 10
4: 153
1124812178_1124812183 -6 Left 1124812178 15:32952100-32952122 CCTTTCCTGCAGTGGCAACTGAA 0: 1
1: 0
2: 0
3: 21
4: 192
Right 1124812183 15:32952117-32952139 ACTGAATGGCTGGGTTTTATAGG 0: 1
1: 0
2: 0
3: 9
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124812178 Original CRISPR TTCAGTTGCCACTGCAGGAA AGG (reversed) Intronic
902441518 1:16433262-16433284 TGCAGCTGTAACTGCAGGAAGGG - Intronic
904090028 1:27938336-27938358 TTAAGTTGCCACTGCCTGTATGG + Intronic
904871505 1:33621925-33621947 TTCAGTATCCACACCAGGAATGG - Intronic
907508495 1:54940580-54940602 GTCACTTGCCACTCCTGGAAGGG + Intergenic
908146339 1:61248653-61248675 TTAAGTTGGGACTGCAGTAAGGG - Intronic
908905586 1:69005311-69005333 ATCTGCTGCCACAGCAGGAAAGG + Intergenic
908907224 1:69029553-69029575 TTCAGGTGCCACTGGTGGATTGG - Intergenic
909158948 1:72119688-72119710 TTTAGTTGCCACAGCTGGCAGGG + Intronic
912215601 1:107607582-107607604 GTCTCCTGCCACTGCAGGAAAGG + Intronic
913595454 1:120371707-120371729 TGCAGTTCCCACTGCAGAAAAGG - Intergenic
914091820 1:144507268-144507290 TGCAGTTCCCACTGCAGAAAAGG + Intergenic
914306719 1:146426596-146426618 TGCAGTTCCCACTGCAGAAAAGG - Intergenic
914595330 1:149146206-149146228 TGCAGTTCCCACTGCAGAAAAGG + Intergenic
915668884 1:157470463-157470485 TTCACCTGCCACTGAAGGACAGG - Intergenic
916419527 1:164623323-164623345 TTCTGTAGCCACTGCTGGAGAGG + Intronic
919724995 1:200875953-200875975 TTCAATAGCTACTGCAGGAGGGG - Intergenic
922456067 1:225774582-225774604 TTCAGAAGCCACAGCAGGAAAGG + Intergenic
922567498 1:226610568-226610590 TTCACTTGGCAGTGCTGGAAGGG - Intergenic
922597383 1:226824377-226824399 TTGGGTTGGCACAGCAGGAACGG - Intergenic
922984960 1:229859224-229859246 ATCAGTGGCCAATGCAGCAAAGG - Intergenic
923068202 1:230539270-230539292 CTTAGTTGCAACTGCAGGGAAGG + Intergenic
923157105 1:231289034-231289056 TTCGGTTGCCACTGCTGGCTTGG + Intergenic
1064564594 10:16626673-16626695 TTCAGTTGCCACATCTGAAAAGG + Intronic
1066137160 10:32460524-32460546 ATCAGGTTCCAGTGCAGGAAGGG + Intronic
1067910223 10:50339031-50339053 TTGAGATGCCACTGCAGGCTGGG - Intronic
1068957528 10:62831875-62831897 TCCAGGTTCCTCTGCAGGAAGGG + Intronic
1070961902 10:80505311-80505333 TGCAGTTGCGGCTCCAGGAAGGG + Intronic
1072895390 10:99362154-99362176 CCCAGCTGCCACTGCTGGAATGG + Intronic
1074153062 10:110775693-110775715 TCCAGTTTCCTCTGCAGGAGTGG - Intronic
1076451339 10:130559034-130559056 TTAAGATGCCTCTGCAGCAAGGG + Intergenic
1077701091 11:4443448-4443470 TGCAGTTTGCACTGCAGGGAAGG + Intergenic
1078253883 11:9640758-9640780 TTGTGTGGCCACTGCAGGCAGGG + Intergenic
1081209825 11:40319072-40319094 TTCTGTTACCACTGAAGGATCGG - Intronic
1082811359 11:57480980-57481002 TTCAGTGGCCTCTGGAGAAACGG + Intergenic
1084084310 11:66847886-66847908 TACTGTCCCCACTGCAGGAAAGG + Intergenic
1085296663 11:75435284-75435306 TTCAGATGCCCCTGCAGGCCTGG - Exonic
1085351481 11:75800763-75800785 TTCCTTTGTCACTTCAGGAAGGG - Exonic
1088656417 11:112004282-112004304 AGCAGCTGCCACTGCAGGAAAGG + Intronic
1090615743 11:128512975-128512997 TTCCGCTGCAACTGCAGCAACGG + Intronic
1091848240 12:3674176-3674198 AGCAATTGTCACTGCAGGAAGGG + Intronic
1093061636 12:14613556-14613578 TACATATGCCACTGCAGGAAGGG + Intronic
1093589173 12:20879445-20879467 TCCAGTTGCAACCGTAGGAATGG - Exonic
1093823881 12:23657668-23657690 TTTTGTTGCCACGGCAAGAATGG - Intronic
1094243427 12:28257197-28257219 TTCAGGTGCCACTTGAAGAATGG + Exonic
1097913920 12:65000162-65000184 AACAGTTGCCACTGTAGAAAAGG + Intergenic
1097978253 12:65710686-65710708 TTCAATTTCCACTGCATGCAGGG + Intergenic
1099033112 12:77553779-77553801 TTCTGTTGCCACAGCCAGAAAGG - Intergenic
1100170310 12:91968320-91968342 TTCAGTTGCAAATACAGGAGAGG - Intergenic
1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG + Intergenic
1104881590 12:132075112-132075134 TACAGATGCCACTGGAGGAAGGG + Intronic
1108610133 13:52077223-52077245 TTCAGTGCCCACTGCTGGAGAGG - Intronic
1109217211 13:59603433-59603455 TACAGCTGCCACTGCTAGAAAGG + Intergenic
1110443313 13:75549419-75549441 GTCGGTTGACACTGCAAGAATGG + Intronic
1111966040 13:94862721-94862743 TACAGGTGTCACTGCAGCAAGGG + Intergenic
1114529786 14:23388519-23388541 CCCAGATGCCACTGCAGGTAGGG - Intronic
1117316869 14:54579732-54579754 TTCTGTGGCCTCTGCATGAATGG + Intronic
1117644223 14:57834557-57834579 TTCTGTTGCCAGTGAAGGGAGGG + Intronic
1118634958 14:67739960-67739982 GTCACATTCCACTGCAGGAATGG + Intronic
1118895182 14:69939928-69939950 TTCAGGTGCCAGAGCAGGGATGG + Intronic
1120392273 14:83924233-83924255 TTGAGTTCCCACAGCTGGAATGG + Intergenic
1121968218 14:98330270-98330292 ATCATTTTCCACTTCAGGAATGG + Intergenic
1124654247 15:31495674-31495696 GTCAGTTGCCACTGAAAGATAGG - Intronic
1124812178 15:32952100-32952122 TTCAGTTGCCACTGCAGGAAAGG - Intronic
1126863588 15:52912872-52912894 AGCAGTTGCCACTGCAAGAAAGG - Intergenic
1130628500 15:85540512-85540534 CTCAGTTGACACTGTAGGAAAGG + Intronic
1130848283 15:87767970-87767992 CTCATTTGCCAGTGCAGGATTGG - Intergenic
1131094669 15:89647814-89647836 TGGAGTTCCCACTGCAGGTAGGG - Intronic
1136130379 16:28216762-28216784 TTTAGTTGGCACTGCAGGGATGG + Intergenic
1137478188 16:48828958-48828980 TTCAGTTTCTCTTGCAGGAATGG + Intergenic
1137614210 16:49837326-49837348 TTCATTTGCCAGTTGAGGAAAGG - Intronic
1139082477 16:63539910-63539932 TTCTGTTTCCATTGGAGGAAAGG + Intergenic
1140150201 16:72355394-72355416 TTTACTTGCCACTTCAGGATTGG - Intergenic
1140252943 16:73310445-73310467 TTCAGTTGCATATGCAGGAAAGG - Intergenic
1140404329 16:74698172-74698194 TTCTGTTGCCCATGCTGGAATGG - Intronic
1141153165 16:81578776-81578798 TTCCGACGCCAGTGCAGGAAGGG - Intronic
1144185399 17:12790855-12790877 TTCCTTTGCCACAGCAGCAACGG - Intronic
1144538908 17:16119796-16119818 TTCCTTTGACACTGCAGGAGAGG - Intronic
1145930395 17:28681210-28681232 TTCAGTCATCACTGCAGAAAGGG - Intronic
1146239344 17:31202447-31202469 TTAATTTTCCACTGCAGGAATGG - Intronic
1146409099 17:32566571-32566593 TTGAGTAGCCACTGAAGGAGGGG + Intronic
1148766934 17:50045023-50045045 TTCAGTTGGCCTTGAAGGAAGGG + Intergenic
1150079412 17:62223458-62223480 TGAAGATGCCACTGCAAGAACGG - Intergenic
1150620474 17:66804076-66804098 TTCACTTCCCACTGCGGGGAGGG - Exonic
1151226196 17:72650061-72650083 TTCAGAGGCCACTTCAGAAATGG + Intronic
1151794251 17:76332702-76332724 TTCAGATGTCACTGCAGTAACGG - Intronic
1153531681 18:6053283-6053305 CTGAGTTTCCACTGCAGGACTGG + Intronic
1154974212 18:21441460-21441482 TACAGTTTCCCCTGCAGGAATGG - Exonic
1155541267 18:26870836-26870858 TTCAGTTACTCCTGCAAGAATGG - Intergenic
1155685443 18:28542815-28542837 TTCAGTTGACAATGTAGAAAGGG - Intergenic
1155780970 18:29835534-29835556 TTCATGTGGCAGTGCAGGAATGG - Intergenic
1157305555 18:46514592-46514614 TCCAGTTGCCCTTTCAGGAAAGG - Intronic
1157862059 18:51150671-51150693 TGAAGCTGCCACTGCAGGTAGGG + Intergenic
1158067228 18:53425138-53425160 TGAAGTTGCCACTTCAGAAAAGG - Intronic
1158117841 18:54016390-54016412 TTCAGGTCTCAGTGCAGGAATGG - Intergenic
1158544224 18:58382029-58382051 TTCAGTTGACTTTGCAGAAATGG + Intronic
1165331970 19:35145078-35145100 TGCCGTTGCCCCTGCAGGACTGG - Intronic
1167991154 19:53362027-53362049 TGCAGCTGCCCCTGCAGGCAAGG - Intergenic
1168371013 19:55834557-55834579 TTCAGTTGCCTCTTCAGAAGTGG - Intronic
1168511106 19:56974281-56974303 TTCAGTCGGCACAGCTGGAAGGG + Intergenic
925604143 2:5641062-5641084 TGCAGTTCCCACTGCAGAAAAGG - Intergenic
927046351 2:19282872-19282894 TTCTTCTGCCACTGCAGGGAAGG + Intergenic
929458434 2:42083590-42083612 TTCACTTGCAACTGAAAGAAGGG - Intergenic
930562832 2:52982322-52982344 ATCAGCTGTCACTGCATGAAGGG + Intergenic
930824849 2:55686423-55686445 GTCAGGTGACACTGCAGTAATGG - Exonic
931319545 2:61162837-61162859 TTCAGTTTCCAAGGCAGGAAAGG + Exonic
932504516 2:72215823-72215845 TATAGTAGTCACTGCAGGAAAGG + Intronic
932559895 2:72857783-72857805 TTCACTTACCACTGGAGGACTGG + Intergenic
936286013 2:111182000-111182022 TACAGGTGTGACTGCAGGAATGG - Intergenic
936394855 2:112117706-112117728 TTCAGTTTCTGCTGCAGTAATGG + Exonic
937424165 2:121784364-121784386 TTCATTTTCCACTGCAGAACTGG + Intergenic
937737415 2:125309146-125309168 TTCATTTGTCTCTGAAGGAAAGG + Intergenic
939269891 2:139924926-139924948 TTCAGTTGTAACAACAGGAAAGG + Intergenic
942932831 2:181516523-181516545 TTAAGTTGCCCTTCCAGGAAGGG + Intronic
943294252 2:186116846-186116868 ACCAGTTGCCACTGCTGGCATGG + Intergenic
944006064 2:194907789-194907811 TTGACATGCCACTGCAGGGATGG - Intergenic
948124742 2:235556346-235556368 TTCTGTAGCCACTGGAGCAAAGG - Intronic
1169385764 20:5148176-5148198 TTCTGTTGCAATGGCAGGAAGGG - Intronic
1169889953 20:10441513-10441535 TTCTGTGGGCACAGCAGGAAGGG + Intronic
1171301720 20:24067062-24067084 TTCAGCTGACAATACAGGAATGG + Intergenic
1172794212 20:37526078-37526100 TTGAATTGTCACTGAAGGAAGGG + Intronic
1176678671 21:9805388-9805410 TTCAGCAGCCACAGCAGCAATGG - Intergenic
1177873967 21:26609099-26609121 TTCCATTGCCACTGAAAGAAAGG + Intergenic
1181410328 22:22713842-22713864 TTAAGATGCCACTGAATGAAGGG + Intergenic
1182049230 22:27300331-27300353 TTCTGCTGCCCCTGCAGGGAAGG - Intergenic
1184003648 22:41693458-41693480 TACAGGTGCCACTGCAGAAGCGG + Exonic
1184281825 22:43441821-43441843 CTCATTTGCCACTGCATGGAAGG + Intronic
1185048313 22:48540219-48540241 TTCATTTCCCACTGCAGCACCGG + Intronic
950174092 3:10860301-10860323 TGTAGTTTCCACTGCCGGAATGG - Intronic
952952184 3:38533839-38533861 ATCAGCAGTCACTGCAGGAACGG - Intronic
953430082 3:42832105-42832127 TGCAGTTGCCACTAGAGGAAAGG - Intronic
955108424 3:55923617-55923639 TTCAGTTGCAGCTCCAGGATAGG + Intronic
955852378 3:63234414-63234436 TTGGGTTCCCACTGGAGGAAAGG + Intronic
956454087 3:69403541-69403563 TTTAGTAGCAACGGCAGGAATGG - Intronic
959334597 3:105048324-105048346 ATCAGCTGCCACTTCAGGACAGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
963386051 3:144596811-144596833 TTTAGATGTCATTGCAGGAAGGG - Intergenic
966112461 3:176419391-176419413 TTCTGAGGCCACTGCTGGAAGGG + Intergenic
967954493 3:194867909-194867931 TTCAGCTACAACTACAGGAAGGG - Intergenic
969228819 4:5815893-5815915 ACCAGTTGCCACAGGAGGAAAGG - Intronic
969424120 4:7113968-7113990 TCCAGTTGCCACGGCAAGTATGG + Intergenic
971116180 4:23647930-23647952 TTCAGTTGTCACTACTGGAGAGG + Intergenic
977266015 4:94855653-94855675 TCCAGTTACCACTGAAGAAAAGG + Intronic
982119874 4:152132506-152132528 AGCAGCTGCCAATGCAGGAAAGG - Intergenic
982929314 4:161382389-161382411 TTCAATTGCCACTCCAGGTATGG + Intergenic
983503921 4:168531826-168531848 CTCAATTGCCAAAGCAGGAAAGG - Intronic
983926873 4:173412152-173412174 TGCAGTGGCCACTGCATGAGTGG - Intergenic
984379253 4:178969318-178969340 TTCAGTTGACACTGGAGCATGGG - Intergenic
986641779 5:9879053-9879075 TTCAGTTTCCACAGCAGGGCTGG + Intergenic
988588147 5:32525694-32525716 GTCAGGGGCCACAGCAGGAAGGG - Intergenic
989579154 5:43016080-43016102 TTCGGATGACACAGCAGGAAGGG + Intergenic
993571279 5:89542204-89542226 TTCACTACCCACTTCAGGAAAGG + Intergenic
994000395 5:94772636-94772658 CTCAGTTGAAACTGTAGGAAAGG + Intronic
998428772 5:142052223-142052245 TCCAGTTGACACTCAAGGAAAGG + Intergenic
1001962653 5:175889419-175889441 TTCAGATGAGACTGCAGGACTGG - Intergenic
1003447175 6:6195275-6195297 TTGAGTTGCCAAAGGAGGAAGGG - Intronic
1003673254 6:8179672-8179694 CTGAGTTGGCCCTGCAGGAAAGG - Intergenic
1005840540 6:29742278-29742300 TGCAGGTGCTTCTGCAGGAAAGG - Intergenic
1006445091 6:34075506-34075528 ATGAGCTTCCACTGCAGGAAAGG - Intronic
1007816748 6:44530403-44530425 TTCAGCTGCCGATGCAGGAGTGG + Intergenic
1009373194 6:62934372-62934394 TTCTGTTGCCAAGGCTGGAATGG + Intergenic
1009871465 6:69457743-69457765 TTCAGTTTCAACAGCAGTAAAGG - Intergenic
1012173287 6:96046477-96046499 TTCAGATATCTCTGCAGGAAAGG + Intronic
1012224395 6:96688132-96688154 TTAAGTTCCAACTGCTGGAATGG - Intergenic
1012719187 6:102719811-102719833 TGCAGTTGCAACTGCAGAAGAGG - Intergenic
1012936856 6:105377392-105377414 TATAGTTGCCACTTCAAGAAAGG - Exonic
1013605312 6:111742048-111742070 TTCAGTTGGAACTTCTGGAAGGG - Intronic
1015090444 6:129350459-129350481 GTCATGGGCCACTGCAGGAAGGG - Intronic
1015567817 6:134591669-134591691 TACAGGTGCCAAGGCAGGAAAGG + Intergenic
1017538486 6:155374231-155374253 TTCAGTTTCCTCTGCATAAACGG + Intergenic
1018366614 6:163126913-163126935 GTCAGATGCCACTGGAGGGAGGG + Intronic
1021434966 7:20603576-20603598 AACAGTTGCCACTACAGGCATGG - Intergenic
1021857679 7:24873382-24873404 TTCAGTTGCTAACGTAGGAAAGG - Intronic
1023159857 7:37286469-37286491 TTCATGTGGCACTGCAGAAAGGG - Intronic
1023639126 7:42240043-42240065 CTCAGGAGCAACTGCAGGAAAGG - Intergenic
1024131254 7:46354910-46354932 TACAGAGGCCACTGCAGGGAAGG + Intergenic
1028708192 7:93875076-93875098 TCCAGTTGCCAGTCCTGGAAAGG + Intronic
1029351605 7:100016663-100016685 TACAGGGGGCACTGCAGGAAAGG - Intronic
1031829475 7:126608645-126608667 TTCAGTTGCAACACCAGGGAAGG - Intronic
1032509568 7:132461531-132461553 TCCAGTTTTCAATGCAGGAAAGG - Intronic
1032633181 7:133676343-133676365 TTTAGCTGCAACTGCTGGAATGG + Intronic
1033155646 7:138954791-138954813 TTCAGTTTCTTCTGCAGGACGGG - Intronic
1034058876 7:148067734-148067756 TTCAGCTGCCAGGGCAGGTAGGG + Intronic
1035938549 8:3869654-3869676 TCTAGTTGCCACAGGAGGAAAGG + Intronic
1037501562 8:19490574-19490596 ATCAGTTGGCTCTGCAGAAAAGG - Intronic
1037761427 8:21744295-21744317 GGCAGTGTCCACTGCAGGAAAGG + Intronic
1039794500 8:40900926-40900948 TTTAGTTGTCCCTGAAGGAAAGG + Intergenic
1041571527 8:59342913-59342935 TTCATTTGCCACAGGAGGAATGG + Intergenic
1044290159 8:90458794-90458816 TTTAGTTGTCACTGCAGGCCTGG - Intergenic
1044889056 8:96813077-96813099 TCCTGTTGTCACTGCGGGAAAGG - Intronic
1045011865 8:97965457-97965479 TTGAGGTGCAACTGTAGGAAAGG + Intronic
1048000423 8:130375276-130375298 TCTATTGGCCACTGCAGGAATGG + Intronic
1050542322 9:6681162-6681184 TTCAGGTGCCGCTGGAGAAATGG + Intergenic
1050922709 9:11225881-11225903 TTTAGTTGTCACACCAGGAATGG + Intergenic
1051116767 9:13704112-13704134 TTCAGTTACCACTTTAGCAAGGG - Intergenic
1051900694 9:22035996-22036018 TTCAGTTTCCACTATTGGAAGGG + Intergenic
1052615812 9:30839686-30839708 TTGAGTTGCCACTGGAAGAAAGG + Intergenic
1054933787 9:70665125-70665147 TTCAGCTCCCACTCCAGGCAGGG - Intronic
1056070924 9:82985777-82985799 TTCAGAAGCCACTGGAGGCAAGG + Intronic
1058480169 9:105384741-105384763 TTCAGTTTTCTCTGTAGGAATGG + Intronic
1058767764 9:108198524-108198546 TTGAGCTGCCACAGCAGGATAGG + Intergenic
1060003721 9:119981262-119981284 CTCAGCTGACACTGCAGAAAGGG + Intergenic
1061246622 9:129404123-129404145 TGCAGTTGCTACTGCAGCAGTGG + Intergenic
1203663841 Un_KI270754v1:7924-7946 TTCAGCAGCCACAGCAGCAACGG - Intergenic
1186648585 X:11534523-11534545 TTTGGTTGCCACTGCTGGAGGGG - Intronic
1187265217 X:17725987-17726009 TCCAGTTGCCACTGGATGACTGG - Exonic
1187845952 X:23537866-23537888 TTCAGTTTTCTTTGCAGGAAAGG - Intergenic
1189358426 X:40329057-40329079 TTCAGCTGCTGCTACAGGAAGGG + Intergenic
1189440752 X:41033673-41033695 TCCATCTGCCACTGCAGAAAAGG + Intergenic
1189613253 X:42759762-42759784 TTAAGTAGCCACTCCAGGACTGG - Intergenic
1192553058 X:72069282-72069304 TTCATCTGCCTCTGCAGAAAGGG - Intergenic
1195150118 X:102059079-102059101 TCCAAGAGCCACTGCAGGAAAGG - Intergenic
1196570300 X:117258966-117258988 TTCAGTTGTCAGTGATGGAAAGG + Intergenic
1201277623 Y:12313600-12313622 TTCAGTTTCCACCTGAGGAAAGG + Intergenic
1201944523 Y:19497491-19497513 TTCAGTTTCATCTGGAGGAAAGG - Intergenic