ID: 1124812240

View in Genome Browser
Species Human (GRCh38)
Location 15:32952805-32952827
Sequence CTCAGGTTATTTAGTAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124812237_1124812240 18 Left 1124812237 15:32952764-32952786 CCTAGCATGAAAGTTAATTAATG 0: 1
1: 0
2: 10
3: 19
4: 188
Right 1124812240 15:32952805-32952827 CTCAGGTTATTTAGTAATAAGGG 0: 1
1: 0
2: 0
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124812240 Original CRISPR CTCAGGTTATTTAGTAATAA GGG Intronic
900829640 1:4956700-4956722 CTCAGCTTATTAAGAAATGAGGG - Intergenic
908792778 1:67799252-67799274 CTCAGACTATTTGGTAAAAATGG - Intronic
910450562 1:87339531-87339553 TTCAGGTTATTTGGAAATAGCGG + Exonic
910778646 1:90902344-90902366 CACAGAATATTAAGTAATAAAGG + Intergenic
911492506 1:98588032-98588054 CAGAGGATATTTATTAATAAGGG + Intergenic
918236247 1:182583197-182583219 CTCAGTTTATTTACTTATTAAGG + Intronic
920941411 1:210486635-210486657 CTAAGGTGGTTTATTAATAAGGG + Intronic
922985024 1:229859845-229859867 CTCATTTTATCTTGTAATAAAGG + Intergenic
1062963488 10:1590900-1590922 CTCAGGTTACTCAGTAAAAGGGG + Intronic
1064291090 10:14034646-14034668 CTCAGGTTATTTATTGATTAGGG - Intronic
1064310183 10:14205503-14205525 CTCAGGTTATGTAGAAATTATGG + Intronic
1064585240 10:16833434-16833456 TTAAGGTTATTGATTAATAAAGG + Intronic
1065719049 10:28607501-28607523 CTCATAGTATTTAGAAATAAAGG - Intronic
1068461202 10:57331324-57331346 CTCTGGTTTATTAGTAGTAAAGG + Intergenic
1069052259 10:63808370-63808392 ATGAGGTTATTAATTAATAATGG + Intergenic
1069215490 10:65813769-65813791 TTTAGTTTATTTAATAATAAAGG - Intergenic
1071735445 10:88293845-88293867 CTCAGGTTATCCAGTGATAATGG - Intronic
1072771627 10:98144816-98144838 GTCAGGTTATTTAGGCCTAATGG + Intronic
1073257601 10:102163716-102163738 ATCAGGTTATTTAGCAAGTATGG - Exonic
1076037876 10:127215897-127215919 CTGAAGGTACTTAGTAATAAAGG - Intronic
1078065853 11:8079152-8079174 GTCAGGTAATTTGGGAATAAAGG + Intronic
1078287114 11:9968007-9968029 CTCAAATTAAATAGTAATAATGG + Intronic
1081066147 11:38542377-38542399 CCCAGGTTATTTATTTATATTGG + Intergenic
1085333933 11:75676198-75676220 CTCAGGTTATTTGGTTTTATCGG + Intergenic
1085803998 11:79617849-79617871 CTCATGATATGTACTAATAAGGG + Intergenic
1085810451 11:79675968-79675990 CTCAGGGTCTTTGTTAATAATGG - Intergenic
1086547705 11:88017321-88017343 CTCAAATTAGTTGGTAATAAAGG + Intergenic
1086642067 11:89171180-89171202 ATCAGGTTATTTAACTATAAAGG + Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087454832 11:98371904-98371926 CTCAGGTTATTTGTTGATTATGG - Intergenic
1088926042 11:114304121-114304143 CTAAAGTTATTTAGTAAATAAGG + Intronic
1092555764 12:9559952-9559974 CTCAGGTTCTGTATTCATAAGGG - Intergenic
1093064492 12:14642307-14642329 CACACCTTATTTAGTAATAACGG + Intronic
1093508607 12:19899715-19899737 CTCAATTTCATTAGTAATAAGGG - Intergenic
1093689869 12:22098580-22098602 CTCTAGTTATTTAGTTGTAATGG + Intronic
1093750439 12:22792876-22792898 CTCAGGATATTTCATCATAAAGG + Intergenic
1094516335 12:31130725-31130747 CTCAGGTTCTGTATTCATAAGGG + Intergenic
1095614403 12:44171313-44171335 CTCAAGATATTTATTAATAAAGG - Intronic
1095736908 12:45567595-45567617 CCCAGGTTCTTGAGTAATTACGG + Intergenic
1096012505 12:48232273-48232295 CTAAGGTGATTTATTAATAATGG + Intergenic
1096753162 12:53776159-53776181 CTAAGGATATTTCCTAATAAGGG - Intergenic
1098583486 12:72129886-72129908 CTTAGGTGATTTACTAATAAAGG + Intronic
1099554661 12:84097064-84097086 GTCAGTTTGTTTAGCAATAAAGG + Intergenic
1102548055 12:113670738-113670760 CCCAGGTTCTTTAGTAAGGAAGG + Intergenic
1102612393 12:114123885-114123907 TTATGGTTATTTAGTGATAAAGG + Intergenic
1105614849 13:22002404-22002426 CTCAGATTATGTAATAATGATGG - Intergenic
1106000502 13:25718764-25718786 CTAAGGTTAGTTAGAAGTAAAGG + Intronic
1106597399 13:31158085-31158107 TTCAGGTTACTTAGTAATTAAGG - Intronic
1107074357 13:36305942-36305964 GCCAGGCTATTTAGTAATAGAGG - Intronic
1107262254 13:38507303-38507325 CTCAGTTTATTCAGTCATTATGG - Intergenic
1108756578 13:53510348-53510370 CCAAGGTTATATACTAATAAGGG + Intergenic
1111048229 13:82845197-82845219 CTCAGATTCATTAGTAATAAAGG + Intergenic
1112133132 13:96546075-96546097 TTCAAGTTATTTAGTAACAGTGG + Intronic
1112182375 13:97096427-97096449 TTCAACTTATTTAGTAATCATGG - Intergenic
1112453600 13:99536056-99536078 CTCAGGTTATTCAATAAAAAAGG - Intronic
1112977054 13:105333222-105333244 CTTAGGTATTTTAGTATTAAAGG - Intergenic
1112999471 13:105617103-105617125 CAAAGGTTATTTAATACTAATGG + Intergenic
1114622131 14:24102560-24102582 CTCAGGTTGTTTAGCCATGAAGG - Intronic
1115286331 14:31716993-31717015 CTCAGATTATATAGGAATATAGG - Intronic
1115513709 14:34164198-34164220 CTCAATTTCTTTAGTAATCAAGG + Intronic
1116850069 14:49900170-49900192 CTCAGGCTATTCAGTTGTAATGG - Intergenic
1117851885 14:59981405-59981427 ATCAGGTAATTCAGTAATTACGG - Intronic
1119413766 14:74455981-74456003 CTAAGGTTATTTAGGTATTAAGG + Intergenic
1119755666 14:77117375-77117397 CTCATGTTATTTGGGAATATTGG + Intronic
1123927405 15:25130387-25130409 TTCAGTTTATTTAATAATACAGG + Intergenic
1124812240 15:32952805-32952827 CTCAGGTTATTTAGTAATAAGGG + Intronic
1126904637 15:53351102-53351124 CTCATGTTAGTTAGTAACAGTGG + Intergenic
1127171627 15:56309251-56309273 CTGAGGTTTTTTATTAAGAAAGG + Intronic
1128251876 15:66169505-66169527 CGCAGGTTAATTGGGAATAATGG - Intronic
1131452287 15:92552787-92552809 CTAAGATTATTCAGGAATAAAGG + Intergenic
1140208977 16:72956040-72956062 CTCAAATCATTTGGTAATAAAGG + Intronic
1140882327 16:79210196-79210218 GTCAGGATATCTAGTAACAATGG - Intronic
1143374246 17:6457982-6458004 CTCAGGTTAAGTAATAATGAAGG + Intronic
1145894868 17:28449860-28449882 CCCAGATTCTTTAGAAATAAAGG + Intergenic
1146311805 17:31774979-31775001 CTCAGGGTATTTAGGCACAACGG - Intergenic
1150566890 17:66349939-66349961 ATCAGGTTATTTAGTTACAGAGG + Intronic
1153188383 18:2511142-2511164 CTTAGGTGATTTTTTAATAAGGG + Intergenic
1153725199 18:7947121-7947143 CTCAGGTTTATCAGTAATAAAGG + Intronic
1155512790 18:26594309-26594331 ATAAGCTTATTTAGTAATATAGG + Intronic
1156131562 18:33982336-33982358 CTCATGTAATTTAAAAATAAAGG + Intronic
1159452051 18:68614997-68615019 ATGAGTTTATTTAGTAATGAAGG - Intergenic
1159768637 18:72521894-72521916 TACAGATTATTTAGTAAAAAAGG + Intergenic
1159873787 18:73787954-73787976 CTCAGGTGAGTTAGTAATTCAGG - Intergenic
1165084579 19:33334991-33335013 CTGAGGTCATTTATTATTAAAGG + Intergenic
925397684 2:3547878-3547900 CTTAGCTTATTTGGTCATAATGG + Intronic
928943555 2:36752062-36752084 CTCAGATTAATTTGTACTAAAGG + Intronic
929595883 2:43175517-43175539 CTGAGGCTAATTAGTAATAATGG - Intergenic
929717063 2:44323054-44323076 CTTAGCTAATTTAGTAATTAAGG + Intronic
932547404 2:72728551-72728573 CTCATGTTATATACTCATAATGG + Intronic
933032054 2:77341104-77341126 CTCATGTTAAGTATTAATAAAGG - Intronic
933152604 2:78933099-78933121 CTCAGTCTATTTAATATTAATGG - Intergenic
939450157 2:142363617-142363639 CGTAGGTTATTAAATAATAAGGG + Intergenic
943580724 2:189681039-189681061 CTCAGGTAAATTTGTAAAAAGGG - Intronic
944249593 2:197567798-197567820 CTTGGCTTATTTAGCAATAAAGG - Intergenic
944752689 2:202727260-202727282 CTCAGGTTGTTTTATAATACTGG + Intronic
945414617 2:209555549-209555571 TTCTAGTTTTTTAGTAATAAAGG + Intronic
945831935 2:214798071-214798093 CAGAGGTAATTTAATAATAATGG - Intronic
947011337 2:225570388-225570410 CTCAGGTTATTTCTTTATAGTGG - Intronic
1177391876 21:20485894-20485916 CTCAGGATATTTTATAATCAGGG - Intergenic
1179604967 21:42509191-42509213 CTCATATTATTTAGAAATATAGG - Intronic
1179914693 21:44468559-44468581 CTCATGTCATTTATTAAAAAGGG - Intergenic
1183756780 22:39774515-39774537 CTCAGGTTATTTTGGAACTATGG + Intronic
1184225378 22:43126714-43126736 CTCAGGATTTTTAGTCATTAAGG + Intronic
950323092 3:12076512-12076534 ATCATGTTATCTAGTAATGACGG - Intronic
950876603 3:16280422-16280444 CTCAAGTGATTTACTAACAAAGG - Intronic
951129084 3:19020156-19020178 CTTAGGTTACTTACTAATAATGG - Intergenic
953332324 3:42064093-42064115 CTCAGGTCAGATAGTAATAAGGG - Intronic
955758414 3:62251019-62251041 ATCGGGTGATTTAGTGATAATGG + Intronic
956987396 3:74717391-74717413 TTCAGGATATTTTATAATAAAGG - Intergenic
957214721 3:77304663-77304685 AGCAGGTTATTTAGCAATATTGG - Intronic
958010852 3:87877609-87877631 CTCAGGTTCTTTACTGGTAATGG - Intergenic
958621053 3:96560864-96560886 GCCAGGTTATTTACTAAGAATGG - Intergenic
959024083 3:101220348-101220370 CTCAGGTTTTTTTTTAAGAAAGG + Intergenic
959847424 3:111050148-111050170 ATCAGGTTTTTTTGTAATCATGG - Intergenic
960221437 3:115114273-115114295 TTCAGGTTACTTAGATATAATGG + Intronic
960301075 3:116003353-116003375 CTCAGATTATTTGACAATAAAGG + Intronic
965041442 3:163512669-163512691 CTCAGCTTGTTTAATAAGAATGG + Intergenic
965663739 3:171069442-171069464 CTCAGCCTGTTTAGTATTAATGG + Intronic
968204309 3:196785534-196785556 CTCAGTTTTTTGAGTAATCAGGG - Intronic
971109533 4:23568676-23568698 CTCAAGTTATTTAGTAGATATGG + Intergenic
973792636 4:54392475-54392497 CACAGGTCATCTGGTAATAAGGG + Intergenic
975136698 4:70881828-70881850 CTCAGTTTATTATGAAATAATGG - Intergenic
975418982 4:74139968-74139990 CACAGGTAAAATAGTAATAAGGG + Intronic
979051517 4:115940109-115940131 CTCAGGACATTTCGTAATTAAGG + Intergenic
983536001 4:168857797-168857819 CTTAGGTTCTTTTGTAATACTGG - Intronic
983849546 4:172563036-172563058 CTCAGATTCTTTAGAAATAAAGG - Intronic
985310859 4:188596970-188596992 CTCAAGTTAGTTGCTAATAAAGG + Intergenic
985480026 5:104012-104034 CTGAGGTTGTTTAGGAATATCGG - Intergenic
987797436 5:22647220-22647242 CTCAGGTTCTTTAGCAGGAAAGG + Intronic
988642488 5:33056384-33056406 CCCACATTATTTAATAATAATGG - Intergenic
990225060 5:53640950-53640972 CTCAGGGAAGTTTGTAATAAAGG - Intronic
994359859 5:98838505-98838527 CTCAGGGTTGTTTGTAATAATGG + Intergenic
995718181 5:115101430-115101452 CCCATGTTATATAGTAGTAAAGG + Intergenic
996180464 5:120412582-120412604 GTCATGTTATCTAGGAATAAAGG + Intergenic
996529911 5:124517810-124517832 CTCAGTTTCTTTAGACATAAAGG + Intergenic
997440893 5:133907914-133907936 TTCAGGCTATTTAGAAATAAAGG - Intergenic
997994431 5:138574596-138574618 CTGAGGTTAAGTTGTAATAAAGG - Intronic
998577943 5:143337260-143337282 CTCAGCTTAATTAGTAATCAGGG + Intronic
999398550 5:151246969-151246991 CTCAAGTTATTTGGAGATAAAGG + Intronic
1004086201 6:12451967-12451989 CATGGGTTATTTACTAATAAGGG + Intergenic
1004194762 6:13493492-13493514 ATCAGTTTCTTTTGTAATAATGG - Intergenic
1004630494 6:17416650-17416672 GTCATGTTATTTAGACATAAGGG + Intronic
1005648103 6:27861332-27861354 CACAGTTTATTTTCTAATAAGGG - Intronic
1006714820 6:36110479-36110501 CTCTGAATATTTTGTAATAAAGG + Exonic
1007233838 6:40376218-40376240 TTCAGAATCTTTAGTAATAAGGG + Intergenic
1007603351 6:43097685-43097707 CTCGGCATATTTAGTAATCATGG - Intronic
1008310946 6:49972802-49972824 TTTAGGGTATGTAGTAATAATGG - Intergenic
1008884310 6:56415374-56415396 ATCATATTATTTAGAAATAATGG + Intergenic
1009317991 6:62247260-62247282 CTCATGTTATTTACTTTTAATGG - Intronic
1009820372 6:68792409-68792431 CTACTGTTATTTAGCAATAATGG - Intronic
1010029170 6:71255288-71255310 CTCAGGTAATTTCTTAAAAAAGG - Intergenic
1012966389 6:105678629-105678651 TTCAGGGTATTTATAAATAATGG - Intergenic
1013139566 6:107318637-107318659 CTCATGTTTTTAAGAAATAATGG - Intronic
1015351820 6:132228452-132228474 CTCCTGTTATTTAATTATAAAGG - Intergenic
1015834227 6:137402690-137402712 CTAAGGTCATTTTCTAATAAGGG + Intergenic
1017442988 6:154481775-154481797 CTCACGTTATTTAGAAAAAGAGG - Intronic
1017701454 6:157076890-157076912 CTCAAGGTATTTAGTTAGAAAGG - Intronic
1017904362 6:158746789-158746811 CTCATCTTTGTTAGTAATAAGGG - Intronic
1020227995 7:6295298-6295320 TTCAGGTTAATTATTTATAATGG + Intergenic
1020666056 7:11045455-11045477 TACAGGGTATTTAGTAGTAAGGG - Intronic
1020914621 7:14177047-14177069 TTCAGGGTATTTATTAATAGTGG - Intronic
1021477147 7:21075002-21075024 CCCAGTTTTTTTTGTAATAATGG + Intergenic
1022052790 7:26695161-26695183 CTGAGGGTATTTAGTGAGAAAGG - Intronic
1023089751 7:36606906-36606928 CTCAGGTTGTTTAAGAAGAAAGG + Intronic
1023582114 7:41694308-41694330 CTCAGGTAATATAGAGATAAAGG - Intronic
1028596311 7:92549482-92549504 CTCAGGTCATTTGTGAATAAAGG + Intergenic
1028839307 7:95410309-95410331 CACAGGTCATTTAGCAATTATGG + Intronic
1031160300 7:118159007-118159029 CACTGGTTATTTAGGAATGAGGG - Intergenic
1031599905 7:123693880-123693902 CTCAGGATATTTAGATGTAAAGG - Intronic
1031705101 7:124970904-124970926 GGCAGGTTATATTGTAATAAGGG - Intergenic
1034357009 7:150459074-150459096 CTCAGATTTTTAAGGAATAAAGG - Intronic
1034359790 7:150484585-150484607 CCCAGGTTATGTGTTAATAATGG - Intergenic
1034379399 7:150677359-150677381 CCCAGGTTATGTGTTAATAATGG - Intergenic
1042007105 8:64193399-64193421 ATCAAGTTGTTTAGTAAAAAAGG - Intergenic
1044296717 8:90536195-90536217 CTCAGGCTTTTTAGTATAAAAGG + Intergenic
1047066289 8:121287563-121287585 CTTAGTTTCTTTAGTATTAATGG - Intergenic
1051275998 9:15399155-15399177 CTCAATTTATTTAGTAGTTATGG + Intergenic
1051925469 9:22319602-22319624 CTCAGATCACTTAGCAATAAGGG - Intergenic
1054918446 9:70517987-70518009 CTCACTCTATTTAGTTATAAAGG + Intergenic
1057092793 9:92274933-92274955 CTCAAGTTATTCAGTCATAAAGG + Intronic
1058930416 9:109713529-109713551 ATAAGGTTATTTAAGAATAAAGG + Intronic
1059645255 9:116259547-116259569 CTCAGGCTTGTTAGTAATCAGGG + Intronic
1189041919 X:37551221-37551243 CTCAAATTCTTTATTAATAACGG - Intronic
1190845472 X:54186826-54186848 CTTAGGGCATTTAGTAAAAAAGG - Intergenic
1192168163 X:68838875-68838897 CACAGGTAATGTAGTAATCATGG - Exonic
1194269767 X:91797796-91797818 CTTAGGGTATTTAGTCAGAATGG + Intronic
1198049040 X:132930758-132930780 CTCTGTTTATTTAGTATTATTGG - Intronic
1200586984 Y:5018777-5018799 CTTAGGGTATTTAGTCAGAATGG + Intronic