ID: 1124818212

View in Genome Browser
Species Human (GRCh38)
Location 15:33018100-33018122
Sequence TACCATCACCTTAAGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124818212_1124818221 1 Left 1124818212 15:33018100-33018122 CCTACCCCCTTAAGGTGATGGTA 0: 1
1: 1
2: 4
3: 25
4: 123
Right 1124818221 15:33018124-33018146 TAGGAGATGGAGCCTTTGGGAGG 0: 11
1: 88
2: 595
3: 1506
4: 2488
1124818212_1124818224 18 Left 1124818212 15:33018100-33018122 CCTACCCCCTTAAGGTGATGGTA 0: 1
1: 1
2: 4
3: 25
4: 123
Right 1124818224 15:33018141-33018163 GGGAGGTGATCAGGTCATGAAGG 0: 24
1: 403
2: 1316
3: 3112
4: 7261
1124818212_1124818220 -2 Left 1124818212 15:33018100-33018122 CCTACCCCCTTAAGGTGATGGTA 0: 1
1: 1
2: 4
3: 25
4: 123
Right 1124818220 15:33018121-33018143 TACTAGGAGATGGAGCCTTTGGG 0: 1
1: 21
2: 171
3: 926
4: 2232
1124818212_1124818219 -3 Left 1124818212 15:33018100-33018122 CCTACCCCCTTAAGGTGATGGTA 0: 1
1: 1
2: 4
3: 25
4: 123
Right 1124818219 15:33018120-33018142 GTACTAGGAGATGGAGCCTTTGG 0: 1
1: 15
2: 131
3: 788
4: 1995
1124818212_1124818222 9 Left 1124818212 15:33018100-33018122 CCTACCCCCTTAAGGTGATGGTA 0: 1
1: 1
2: 4
3: 25
4: 123
Right 1124818222 15:33018132-33018154 GGAGCCTTTGGGAGGTGATCAGG 0: 1
1: 63
2: 574
3: 1574
4: 2790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124818212 Original CRISPR TACCATCACCTTAAGGGGGT AGG (reversed) Intronic
901936928 1:12633256-12633278 CACCATCACCTTGTGGGGGTGGG - Intergenic
903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG + Intronic
903676969 1:25070560-25070582 TACCATCACATTGTGGGGGTTGG - Intergenic
907661635 1:56398548-56398570 ATCCATCACCTTAAGGGAATGGG - Intergenic
909122419 1:71620088-71620110 ATCCATCACTTTAAGGGGATAGG - Intronic
910369728 1:86503211-86503233 TCCAATCTCCTTAAGGGGGATGG - Intergenic
911659619 1:100486628-100486650 TGCCATCACCTTGTGGGGTTGGG + Intronic
912351000 1:109012989-109013011 TACCATTACCTTGCGGGGTTAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913355235 1:117913789-117913811 TACCATCACATTAGGGGGTAGGG - Intronic
913575519 1:120169891-120169913 TACCATCACTTTGGGGGGTTAGG - Intronic
914557829 1:148785533-148785555 TACCATCACTTTGGGGGGTTAGG - Intergenic
914615005 1:149344697-149344719 TACCATCACTTTGGGGGGTTAGG + Intergenic
914907245 1:151756671-151756693 TACAACCCCCTCAAGGGGGTTGG + Intergenic
919951290 1:202366137-202366159 TACCATGACATGAAGGAGGTAGG - Intronic
921801186 1:219404233-219404255 TGCCATCACATTAAGGGGTTGGG + Intergenic
923198822 1:231692467-231692489 TGCCATCTCCTAAAAGGGGTGGG - Intronic
923405553 1:233655572-233655594 TACCATCACCTTGAGAGGGTGGG - Intronic
924226849 1:241928993-241929015 TACCATCACCCTGGGGGGTTAGG - Intergenic
1065338485 10:24679438-24679460 AACCATCACCTTGAGGGTTTGGG + Intronic
1066660782 10:37736852-37736874 TACCATCACATTAGGGGTTTAGG + Intergenic
1067338787 10:45384481-45384503 TAGCATCAGCTGAAGGGGGCTGG + Intronic
1072735971 10:97880042-97880064 TACCATCACCTGAAGGGCCAGGG - Intronic
1076167293 10:128292826-128292848 TATCATCACCTTTGGGGGTTTGG + Intergenic
1079554515 11:21742031-21742053 TACCATCACAATAAGGGGTAGGG + Intergenic
1088319260 11:108538261-108538283 AGCCAACACCTTAAGAGGGTGGG + Intronic
1088324164 11:108585327-108585349 TACCATCACCTTGAGGGGTAGGG - Intronic
1089658768 11:119972064-119972086 CACCATCACTTTGTGGGGGTAGG - Intergenic
1096471834 12:51882814-51882836 TACCATCACCTTGGGGGCTTAGG + Intergenic
1098038373 12:66329564-66329586 TACAAACACATTAAGGGGTTAGG + Intronic
1099552407 12:84064326-84064348 TACCATCACCTTAGGGGTTAGGG - Intergenic
1102531578 12:113550469-113550491 TACCATCAGCTTCATGGGGTTGG + Intergenic
1104327710 12:127815880-127815902 TACCATCACCTTGGGGGTGAAGG - Intergenic
1106171941 13:27296166-27296188 TACCATCACATTAGTGGGGAAGG - Intergenic
1107086818 13:36433852-36433874 TAAGATCACCTTGAGGGGTTCGG + Intronic
1108086547 13:46799109-46799131 TACCATCACGTTAAGGATTTAGG + Intergenic
1110147312 13:72207412-72207434 ACCCATAACCTTAAGAGGGTGGG - Intergenic
1111686503 13:91507720-91507742 TACCATCACATTGAGGGGTTAGG + Intronic
1113172901 13:107526090-107526112 AACCATCAACTTAGGGGGATGGG - Intronic
1115341105 14:32293665-32293687 TACCATCACTTTGGGGGGCTGGG + Intergenic
1117303660 14:54452175-54452197 TACCATCACTTTAGGGGCTTAGG + Intergenic
1118021348 14:61718402-61718424 CACCTACAACTTAAGGGGGTTGG + Intronic
1120930043 14:89839234-89839256 TACCATCCAGTTAAGGAGGTGGG + Intronic
1120967608 14:90181510-90181532 TACCATCACTTTATGGGTGATGG + Intronic
1121383073 14:93491191-93491213 TACCATCACATTAGGGGGTTTGG + Intronic
1121565222 14:94904303-94904325 TAGCATCACCTTAAGGAGCTGGG + Intergenic
1121881109 14:97500959-97500981 TACCATCACATTGAGGGGTTAGG + Intergenic
1122045860 14:99022856-99022878 TACTATCACCTTAGGGGAATGGG - Intergenic
1122647530 14:103205331-103205353 TACAATCACATGGAGGGGGTTGG + Intergenic
1123914305 15:25006643-25006665 TAGCATCAACTGAAAGGGGTAGG - Intergenic
1124818212 15:33018100-33018122 TACCATCACCTTAAGGGGGTAGG - Intronic
1125295752 15:38201324-38201346 AACAATCACTATAAGGGGGTTGG - Intergenic
1126906929 15:53377968-53377990 CACCATCTCCTTAATAGGGTGGG - Intergenic
1135854475 16:25994134-25994156 TACCATCACATTTGGGGGCTAGG + Intronic
1141566831 16:84908205-84908227 TACCAACTCCTTAAAGGGGTGGG - Exonic
1147728474 17:42581743-42581765 CCCCATCACCTTAAGTGGGATGG + Exonic
1148199767 17:45742229-45742251 AACCTTCACCTGAAGGGGGGTGG - Intergenic
1149205096 17:54234751-54234773 TACCATCACCTTGAGGGGGTAGG - Intergenic
1151406518 17:73890676-73890698 TACCATCACCTTGAGGGAATGGG - Intergenic
1155003547 18:21708091-21708113 TACCATCACCTTGAGGGGCTAGG + Intronic
1158172293 18:54613600-54613622 TACCATCACATTAGGGGTTTAGG - Intergenic
1159595407 18:70378251-70378273 TACCATCACCTTGAGGGGTTAGG + Intergenic
1168469559 19:56629424-56629446 TACCATCACCTTAGGGGTTAGGG - Intergenic
925642489 2:5999290-5999312 TACCATCACATTGGTGGGGTAGG + Intergenic
929487752 2:42370074-42370096 TACCATGCCCTTATGGGGCTGGG + Intronic
935839464 2:107093527-107093549 TACAGTCACCATAAGGGGATGGG + Intergenic
939995277 2:148914208-148914230 TACCCTTACCTACAGGGGGTAGG - Intronic
940781467 2:157938066-157938088 TACCATCACATTGGGGGGTTAGG + Intronic
941722945 2:168831351-168831373 TACCATCACATTGAGGGAATAGG + Intronic
942207801 2:173639231-173639253 TCCCATCACTTTGAGGGGGCTGG + Intergenic
942433019 2:175935699-175935721 TAACATTACCTTATTGGGGTTGG + Intronic
944845696 2:203665678-203665700 TACCTTCATCTTAAGGGAGAAGG - Intergenic
945682468 2:212930726-212930748 TATCATCACCGCATGGGGGTGGG + Intergenic
946145418 2:217726909-217726931 TACCATCATCTTGGGGGGTTAGG + Intronic
1174741005 20:53014329-53014351 TACCATCACATTGAGGGTCTGGG + Intronic
1176105176 20:63382465-63382487 TACCAACCCCTTCAGCGGGTTGG - Intergenic
1178516102 21:33248748-33248770 CACCATCACATTAATGTGGTTGG - Exonic
1182036351 22:27201425-27201447 TACCGTCACCATTCGGGGGTGGG - Intergenic
1182942964 22:34295764-34295786 GACCATCATCTTAAAGGGGTAGG + Intergenic
1182957967 22:34445151-34445173 TAATATCACCTAAAGGGAGTTGG - Intergenic
1184528416 22:45039321-45039343 TACCATCAACTTGGCGGGGTTGG + Intergenic
949220847 3:1632290-1632312 TACCATAAACTTCAGGGGGGAGG + Intergenic
951911521 3:27755254-27755276 TACCATCACCTTGGGGGGTTAGG - Intergenic
953035817 3:39209896-39209918 TACCATCACTTGGAGGGGGTGGG + Intergenic
956689577 3:71863534-71863556 TGCCATCACCTTGGGGGGTTAGG + Intergenic
957413752 3:79874199-79874221 TACCATCACATTAGGGGGATAGG - Intergenic
957854535 3:85857215-85857237 TACCATCACATTAGGAGGCTGGG + Intronic
959995862 3:112679492-112679514 TGCCATCACCTTCGGGGGTTTGG + Intergenic
961335179 3:126171774-126171796 TCTCATCACCTAAAAGGGGTAGG + Intronic
962024465 3:131532654-131532676 TACCATCACATTGAGGGGTAGGG - Intergenic
966410165 3:179639169-179639191 TTCCATCACCTAAAAGGTGTTGG - Intergenic
973632547 4:52833010-52833032 TTCCTTCACCTTAAGGGGAAGGG + Intergenic
975469284 4:74746834-74746856 TCCCAGCAGCTTAATGGGGTTGG - Intronic
975975979 4:80097218-80097240 TGCCATCACCTTGGGGGGTTGGG + Intronic
977700650 4:100018907-100018929 TACCATCAGCTCAAAGTGGTGGG - Intergenic
980082993 4:128363925-128363947 TACCATCACCTGGGGGGGTTAGG + Intergenic
981628087 4:146784467-146784489 TATCATCACCTTGTGGGGTTGGG - Intronic
983721616 4:170860025-170860047 TACTATCACTTTGAGGGGTTGGG - Intergenic
984167693 4:176321471-176321493 TAGTATCCCCTTAATGGGGTAGG + Intronic
988699102 5:33655347-33655369 AACCAACAACTTAAGGGTGTTGG + Intronic
991191157 5:63875583-63875605 TACCATCACCTTGGGGGTTTAGG + Intergenic
995413052 5:111879952-111879974 TATCATCACCTTAAGGGCTGGGG + Intronic
996049061 5:118910995-118911017 TACCATCACCTTCGGGGGTTAGG + Intronic
1001595285 5:172894752-172894774 TCCCACCACCTTGAGGGGGGCGG - Intronic
1004729096 6:18340428-18340450 TACCATCACCTTAGGGGTTAGGG - Intergenic
1004895430 6:20143326-20143348 TACCATGGCCTTAATGTGGTGGG - Intronic
1005017748 6:21390285-21390307 TACCATCACCTTGGGTGGCTAGG - Intergenic
1007061114 6:38941899-38941921 TACCATCACCTTGGAGGGGGTGG - Intronic
1007305876 6:40904176-40904198 TACCATCACTTAAAGGGGTTAGG - Intergenic
1008594963 6:53032941-53032963 TTCCATCATCTGGAGGGGGTGGG - Intronic
1009670001 6:66736380-66736402 TACCATCACATTGAGGGGCTTGG - Intergenic
1010496601 6:76539994-76540016 TACCGTCACCTTAGGGGGTTAGG + Intergenic
1011574894 6:88786822-88786844 TACCATCACATTAGGGGCTTAGG - Intronic
1013752507 6:113423612-113423634 TACCATCCCATCAAGGGGGCCGG + Intergenic
1014464998 6:121744959-121744981 TCCCATCACCTTAATGAGATGGG + Intergenic
1014888060 6:126806334-126806356 TCCCAACACCTTTATGGGGTAGG + Intergenic
1015340142 6:132089798-132089820 TGCCATCACACTGAGGGGGTGGG - Intergenic
1015971733 6:138749253-138749275 TACCATCACATTGGGGGGTTAGG - Intergenic
1016309056 6:142714000-142714022 CAGCATCCCCTAAAGGGGGTTGG - Intergenic
1017994903 6:159523500-159523522 TGCCATGACCTTAAGGGGGTGGG - Intergenic
1018315109 6:162549041-162549063 TACCATCATCTTGGGGGGGCAGG - Intronic
1018396618 6:163382754-163382776 TTTCATCACCTTGAGGGGGAAGG - Intergenic
1018418220 6:163619958-163619980 TACCATCACCTGGGGGGGTTAGG - Intergenic
1018445386 6:163853538-163853560 TACCATCACATTGGGGGGATGGG - Intergenic
1020530635 7:9329762-9329784 TACCATCACATTGAGGGGTAGGG - Intergenic
1027704687 7:81514471-81514493 TACCATCACATTGAGGGGTGAGG - Intergenic
1030678718 7:112411638-112411660 TACCATCACATTTAGGGGTTAGG - Intergenic
1031954392 7:127927574-127927596 AACCATGAGCTTTAGGGGGTTGG - Intronic
1032419367 7:131765416-131765438 AAGCATCACATCAAGGGGGTGGG + Intergenic
1032783425 7:135182577-135182599 CACCGTCACCTTGAGGGGTTAGG + Intergenic
1032908490 7:136401613-136401635 TACCATCACATTAAGGGTTAAGG - Intergenic
1033915193 7:146315319-146315341 TACCATCACTGCAAGGGGGAGGG - Intronic
1036526755 8:9541934-9541956 TACCATCACATTGAGGGGTAGGG + Intergenic
1037692576 8:21194588-21194610 TATCATCACCTTGGGGGGTTAGG + Intergenic
1038919773 8:32069740-32069762 TACCAAAACCTTGAGGGTGTTGG + Intronic
1042221309 8:66477522-66477544 TACCATCACATTAAGGGTGGGGG - Intronic
1042984977 8:74573513-74573535 TACCATCACACTAGGGGGTTAGG + Intergenic
1044242591 8:89903342-89903364 TACAATCACCTTATGGGGAAAGG + Intronic
1047171045 8:122492519-122492541 TACCATCACCTGAAGGAGTTAGG + Intergenic
1047668236 8:127116039-127116061 TACCATACTTTTAAGGGGGTTGG + Intergenic
1048382616 8:133880711-133880733 TACCATCAGATTAAGGGGTAGGG - Intergenic
1048685212 8:136897369-136897391 TACCATCACCTTAGGGGGCAGGG - Intergenic
1048925476 8:139267378-139267400 CACCATCACCTTGGGGGGTTAGG - Intergenic
1050272272 9:3959098-3959120 TACCATCACCTTAGAGGGTGGGG - Intronic
1054811971 9:69442230-69442252 TACCATGACTTGAAAGGGGTGGG - Intronic
1058235119 9:102480283-102480305 TACCATCACATTAAGAGGACTGG + Intergenic
1061555840 9:131368382-131368404 TACCATCACCTTGGGGGGCTAGG - Intergenic
1186257837 X:7741775-7741797 TACCATGACCTTAGGGTGCTGGG - Intergenic
1187174623 X:16884952-16884974 AACCATCTACTTAAGGGGATAGG - Intergenic
1189014417 X:37081230-37081252 TACTATCAGCTTTAGGGGGATGG + Intergenic
1189406960 X:40733898-40733920 AACCATCACATAAAGGGTGTGGG + Intronic
1192507520 X:71698003-71698025 TCCAATCTCCTTAAGGGGGATGG - Intergenic
1192519176 X:71783549-71783571 TCCAATCTCCTTAAGGGGGATGG + Intergenic
1193459001 X:81767683-81767705 TACCATCACCTTAGGGGTTTAGG + Intergenic