ID: 1124820068

View in Genome Browser
Species Human (GRCh38)
Location 15:33035965-33035987
Sequence GTGTGCTAACATGCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124820068_1124820072 10 Left 1124820068 15:33035965-33035987 CCTGTGTTTGCATGTTAGCACAC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1124820072 15:33035998-33036020 CACCATACCCCACACCACCTCGG 0: 1
1: 0
2: 0
3: 30
4: 293
1124820068_1124820073 11 Left 1124820068 15:33035965-33035987 CCTGTGTTTGCATGTTAGCACAC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1124820073 15:33035999-33036021 ACCATACCCCACACCACCTCGGG 0: 1
1: 0
2: 3
3: 16
4: 190
1124820068_1124820080 28 Left 1124820068 15:33035965-33035987 CCTGTGTTTGCATGTTAGCACAC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1124820080 15:33036016-33036038 CTCGGGACTCCTCAGCAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124820068 Original CRISPR GTGTGCTAACATGCAAACAC AGG (reversed) Intronic
900594414 1:3474165-3474187 GTTTGCATACATGCACACACAGG + Intronic
901493740 1:9609713-9609735 ATGTGCTTTCATGGAAACACAGG - Intronic
908159522 1:61392950-61392972 GTGTGCGCACAGGCACACACAGG + Intronic
908972302 1:69851542-69851564 CTCTTCTAACATGGAAACACTGG + Intronic
913189832 1:116404285-116404307 GTGTGTTAAAATCCAAACATGGG - Intronic
915264489 1:154706891-154706913 GTGTGCAGACATGCACAAACAGG - Exonic
916724594 1:167511371-167511393 GTGTGCATACCTGCACACACAGG + Intronic
917389909 1:174524083-174524105 CTGTGATAACATGCAAGTACAGG + Intronic
918365631 1:183805023-183805045 GTGTGCTCACAAGCACAAACAGG + Intronic
918373729 1:183887509-183887531 GTGTACTCACTTGTAAACACTGG + Intronic
921120792 1:212135144-212135166 GTGTTATAAAAGGCAAACACAGG + Intergenic
921187397 1:212682452-212682474 GTGTGGTAGAATGCAAACAATGG + Intergenic
923262202 1:232278198-232278220 GTGTGCTAATGTGCTAACTCAGG + Intergenic
924769771 1:247068793-247068815 ATGTGCTAATATACACACACTGG + Intronic
1063168272 10:3483473-3483495 ATGTGCACATATGCAAACACAGG - Intergenic
1063313256 10:4976455-4976477 ATGGGCAAACATGCAAAGACAGG - Intronic
1063840516 10:10066438-10066460 GTGTGTTAAGATGAAAAGACAGG - Intergenic
1063960873 10:11304574-11304596 GTGTGCTAACATGCTTGCTCAGG + Intronic
1064524392 10:16238905-16238927 GTGTGCTGTCCTGCAAACTCTGG - Intergenic
1066439654 10:35426167-35426189 GTGTGCTCTCATTCACACACAGG + Intronic
1067492766 10:46727648-46727670 GTATGCTAACATGCTAGCTCAGG + Intergenic
1067601899 10:47612747-47612769 GTATGCTAACATGCTAGCTCAGG - Intergenic
1068895949 10:62201875-62201897 ATATGCTAACATGAAAACAAGGG + Intronic
1073430345 10:103482139-103482161 GTGTACACACATGCATACACAGG - Intergenic
1078235540 11:9481455-9481477 CTCTACTAAGATGCAAACACAGG + Intronic
1080435724 11:32240615-32240637 ATATGCTAACATGAAAAAACTGG + Intergenic
1081234018 11:40623981-40624003 GTATGCACACATGCACACACAGG - Intronic
1081296048 11:41390707-41390729 AAGTGCAAGCATGCAAACACTGG - Intronic
1081433116 11:42998223-42998245 GTGTGCACACATGCATATACAGG + Intergenic
1084431539 11:69114162-69114184 GTTTGCTAACATGAAAAAACCGG - Intergenic
1084734857 11:71098296-71098318 GTGTGCACACATGCACACAGAGG - Intronic
1085210286 11:74770767-74770789 ATGTGGTAACGTGCAAAAACAGG - Intronic
1085593751 11:77789848-77789870 GTGTGCTCACATACCAACAGTGG - Intronic
1086146371 11:83556677-83556699 TTTTGCTAACATGCAAAAAATGG - Intronic
1092443323 12:8528278-8528300 GTGTGCTAACATGCTAGCTCAGG - Intergenic
1098175620 12:67787395-67787417 GTGCGCTAACATGCTAGCTCAGG - Intergenic
1099970731 12:89497372-89497394 GTTTGTTAAAATGCAAACATAGG + Intronic
1103071401 12:117945829-117945851 GAGTGCTAGCGTGCAAACAAAGG + Intronic
1105340266 13:19516774-19516796 GTGTGATAATATGCATATACTGG - Intronic
1105793957 13:23832214-23832236 GTGTGCTCACATGCTAGCTCAGG - Intronic
1106034987 13:26036104-26036126 GTGGGATAACATGAAAACAGAGG + Intergenic
1106875063 13:34062906-34062928 GTGTGTGTACATGCACACACAGG - Intergenic
1107728396 13:43323133-43323155 GTGTGATCACATACACACACAGG + Intronic
1108634822 13:52322933-52322955 GTGTGATAACATGCATCTACTGG - Intergenic
1108652982 13:52500255-52500277 GTGTGATAACATGCATCTACTGG + Intergenic
1111589220 13:90322469-90322491 CTATGCTAACAGGCCAACACTGG - Intergenic
1113104803 13:106760371-106760393 GTGTGCTGACCTGGACACACAGG + Intergenic
1113443533 13:110347855-110347877 GTGTGCAGATATGAAAACACGGG + Intronic
1113971715 13:114196286-114196308 GTGTGCTGACATGGAATCCCTGG + Intergenic
1114951128 14:27755232-27755254 ATATGCAAAAATGCAAACACTGG + Intergenic
1117281505 14:54245975-54245997 GTGTGCTAACGTGCTAACTCAGG + Intergenic
1124782312 15:32647992-32648014 GTGGGCTGAAATACAAACACCGG - Intronic
1124820068 15:33035965-33035987 GTGTGCTAACATGCAAACACAGG - Intronic
1128675817 15:69607745-69607767 GTGTGGTAACATGGAATCAGGGG - Intergenic
1132632469 16:926033-926055 GTGTGCACACATGCGCACACAGG - Intronic
1132632475 16:926145-926167 GTATGCACATATGCAAACACAGG - Intronic
1137984555 16:53096873-53096895 GTGTGCTAACATGTTAGCTCAGG + Intronic
1138855847 16:60690258-60690280 ATGTGCTAACATGCTAGCTCAGG + Intergenic
1139104381 16:63809439-63809461 GTGTGCTCTAATGAAAACACTGG - Intergenic
1141171682 16:81695727-81695749 GTGTGCTCACATGCACAAACAGG + Intronic
1141359062 16:83377576-83377598 ATTTTCTAACATGCAACCACAGG + Intronic
1141392533 16:83676742-83676764 GTGTGCCCACATACACACACTGG - Intronic
1146621240 17:34400002-34400024 GTGTGCTAACATGCAGGGAATGG + Intergenic
1149512156 17:57252310-57252332 GTGTGCTAACATGCACCTATAGG - Intergenic
1152898531 17:82927147-82927169 GTGAGCTAACAAACAAACATCGG - Intronic
1156069193 18:33185414-33185436 CTTTGCAAACATGCAAACACAGG + Intronic
1157467370 18:47958842-47958864 GTGAGCTAAGATGCAAAGGCTGG - Intergenic
1157493880 18:48141871-48141893 AGGTGCTAATATGCAAACAGTGG - Intronic
925875172 2:8305236-8305258 CTGTGCTTTCATACAAACACAGG + Intergenic
926125733 2:10270590-10270612 GTGTGCAAACGTGCACACATGGG + Intergenic
926470035 2:13243460-13243482 GTGTGCCACAATGCAATCACAGG + Intergenic
927578576 2:24221043-24221065 GTGTGCTGATCTGCAAACCCTGG - Exonic
928376470 2:30778699-30778721 GTGTGCCCGCCTGCAAACACAGG + Intronic
928948024 2:36789639-36789661 GTGTGCTCTCATGCATACAGCGG - Intronic
929197666 2:39202787-39202809 ATGTGATAAAATGCTAACACTGG - Intronic
929912511 2:46102266-46102288 GTGTGTTAACAGGCCTACACTGG + Intronic
930077723 2:47420769-47420791 GTGTGCTAACCTGTAAGCCCAGG - Intronic
931569000 2:63648317-63648339 ATGTGCTAAAATGAAAATACTGG + Intronic
933059390 2:77717671-77717693 GTGTGCCAAGATTTAAACACAGG - Intergenic
933063067 2:77762137-77762159 ATGTGCTAACATGCTAGCTCAGG - Intergenic
935129733 2:100252724-100252746 GTGTGCACACATGCACACACAGG - Intergenic
935857758 2:107293687-107293709 ATATACAAACATGCAAACACAGG + Intergenic
936724850 2:115301233-115301255 GTATGCTGACATGCAGAAACTGG - Intronic
939997882 2:148937258-148937280 GTGGGCGAAAATACAAACACGGG - Intronic
940473810 2:154134195-154134217 GTGTGATAACATGCAAAAAATGG + Intronic
941632269 2:167897775-167897797 GAGTGCTAACATGACACCACAGG - Intergenic
945615693 2:212063034-212063056 AAGTGCTCACATGCATACACAGG + Intronic
946908352 2:224437287-224437309 GTTTGCTATCATGCTAACTCTGG - Intergenic
948328588 2:237147213-237147235 GTGTACTAACATACACACAATGG + Intergenic
1170599364 20:17829103-17829125 GTGTACGAACATACACACACTGG - Intergenic
1172301197 20:33851695-33851717 GTGTGAAAACATGAAAACCCTGG - Intronic
1176733942 21:10524986-10525008 GTGTGATAATATGCATATACTGG + Intronic
1177961847 21:27676902-27676924 GTGTTCTAATATGCATACACAGG + Intergenic
1180561691 22:16620458-16620480 GTGTGATAATATGCATATACTGG + Intergenic
1182272802 22:29166071-29166093 GTGTGCACACATGCACACACAGG + Intronic
1185143004 22:49113749-49113771 ATGCTCTCACATGCAAACACAGG + Intergenic
1185181646 22:49366809-49366831 GTGTGGTCAAATGCAAACAGAGG - Intergenic
949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG + Intergenic
954407385 3:50352979-50353001 GTATGTTACCAAGCAAACACAGG - Intronic
962719015 3:138155214-138155236 GTATCTTAAAATGCAAACACAGG - Intergenic
964308997 3:155372274-155372296 GTGTGCATACATGCACACACAGG + Intergenic
966186296 3:177229893-177229915 ATGTGGTCACATGTAAACACAGG - Intergenic
969950691 4:10832074-10832096 ATGTGCTGACATACAGACACAGG - Intergenic
971894241 4:32570282-32570304 GTTTGCTAACATGGAAATATAGG + Intergenic
973220604 4:47722136-47722158 GTGTGAAAACAGGCAAACATTGG - Intronic
974145783 4:57945698-57945720 GTGTTCTTACAGGGAAACACAGG - Intergenic
978527737 4:109682438-109682460 GTGTACAAACATGTAAACAAAGG - Intronic
979527634 4:121734192-121734214 GCATGCTAACATGCTAACTCAGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983553452 4:169038974-169038996 GTGCGCACACATGCACACACAGG + Intergenic
984712148 4:182894926-182894948 GTGTGCTGACACGCACACATGGG + Intronic
985569506 5:637261-637283 ACGTGCTAACACGCAAACTCTGG - Intronic
996586552 5:125094281-125094303 CTGTGCTAAACTGCAAACTCTGG - Intergenic
1000074637 5:157773530-157773552 GTGTTCTAACCTGGAGACACTGG + Intergenic
1001660616 5:173389774-173389796 GTGTGCTAGCATGCAGATCCTGG - Intergenic
1005486031 6:26300393-26300415 GTGTGCAAACAGGAAAAGACAGG + Intergenic
1009672272 6:66771513-66771535 GTGTGCTAACATGCTAGCTTAGG + Intergenic
1010363507 6:75022746-75022768 GTGTGCTAACATGTTCACTCAGG - Intergenic
1011845248 6:91554885-91554907 GTGTGCTATTATGTAAAGACAGG + Intergenic
1016624220 6:146146680-146146702 ATGTGCTAACATGCTAGCTCAGG - Intronic
1016745959 6:147580666-147580688 CTGTGCTAATATGCTACCACTGG - Intronic
1019035264 6:169049539-169049561 ATGTATTAACATGCTAACACTGG - Intergenic
1022197737 7:28084960-28084982 GTGTGCAAACATGCCAGCCCAGG - Intronic
1022961116 7:35427584-35427606 GTGCCCTAACATGCAAACATTGG + Intergenic
1025626179 7:63224473-63224495 GTGTTCTCACATGCAAACTGGGG - Intergenic
1026180586 7:68035975-68035997 GTGTGCTAACATCCTAGCTCAGG - Intergenic
1028115318 7:86990413-86990435 GTGTGCCAACATGCTCACTCAGG - Intronic
1029814333 7:103077499-103077521 GTGTGTTAACATGCTGACTCAGG + Intronic
1031562664 7:123256670-123256692 GTGTGCTAACATTCTAACTCAGG - Intergenic
1034307713 7:150058960-150058982 GTGTGCATCCTTGCAAACACTGG - Intergenic
1034451875 7:151141525-151141547 GGGTGCTAGGAGGCAAACACTGG - Intronic
1034799135 7:154041709-154041731 GTGTGCATCCTTGCAAACACTGG + Intronic
1041346484 8:56904005-56904027 GTGTGCTTACATAAAACCACTGG - Intergenic
1041409658 8:57539453-57539475 GTGGGCAACCATGCCAACACTGG + Intergenic
1044237015 8:89842697-89842719 GTCTTCTAAAATGCACACACTGG + Intergenic
1045191322 8:99887426-99887448 TTGTGGTAAAATGCAAATACAGG - Intronic
1046511676 8:115211960-115211982 GTGTGCTAACATGCTAGCTCAGG - Intergenic
1055253648 9:74339003-74339025 GTCTCTTAACATGCATACACAGG + Intergenic
1058048610 9:100383861-100383883 GTGTGTTAACATGCTAGCCCGGG - Intergenic
1058193526 9:101946924-101946946 GAGTGCAAACATGGAAACAATGG - Intergenic
1059581520 9:115554766-115554788 GTGTGCTAACATACACATAATGG - Intergenic
1059712356 9:116880662-116880684 TTGTGCAAATATGCAAATACTGG + Intronic
1061556963 9:131376600-131376622 TTGTGTTAACAAGGAAACACAGG - Intergenic
1062522251 9:136963012-136963034 GTGTGCACACAGGCACACACAGG + Intergenic
1185750397 X:2606398-2606420 GTGTGCAAACATGGCATCACTGG + Intergenic
1186870463 X:13766355-13766377 GAGTGTGAACCTGCAAACACTGG + Intronic
1187337958 X:18397103-18397125 GTGTGCTAAGATGCTAGCTCAGG + Intergenic
1187704256 X:21993770-21993792 ATCTCCCAACATGCAAACACAGG - Intronic
1191755159 X:64584914-64584936 GTGTTCTTACATGAAAACACAGG - Intergenic
1195727979 X:107936780-107936802 CTGTGCTTACATGCAAACCATGG - Intergenic
1199758315 X:150885534-150885556 GTATTCTAACATGCTAACAGTGG + Intronic