ID: 1124820334

View in Genome Browser
Species Human (GRCh38)
Location 15:33038953-33038975
Sequence GTGTGGGTATCTTGTTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124820330_1124820334 -6 Left 1124820330 15:33038936-33038958 CCTCCTATATACAAAATGTGTGG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1124820327_1124820334 22 Left 1124820327 15:33038908-33038930 CCCACTTTGAAGACTTCTAATGT 0: 1
1: 0
2: 3
3: 18
4: 202
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1124820333_1124820334 -9 Left 1124820333 15:33038939-33038961 CCTATATACAAAATGTGTGGGTA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1124820329_1124820334 -5 Left 1124820329 15:33038935-33038957 CCCTCCTATATACAAAATGTGTG 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1124820325_1124820334 24 Left 1124820325 15:33038906-33038928 CCCCCACTTTGAAGACTTCTAAT 0: 1
1: 0
2: 1
3: 24
4: 282
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1124820326_1124820334 23 Left 1124820326 15:33038907-33038929 CCCCACTTTGAAGACTTCTAATG 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1124820328_1124820334 21 Left 1124820328 15:33038909-33038931 CCACTTTGAAGACTTCTAATGTA 0: 1
1: 0
2: 3
3: 12
4: 229
Right 1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124820334 Original CRISPR GTGTGGGTATCTTGTTAAAA AGG Intronic
900010666 1:104150-104172 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
900026769 1:280716-280738 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
900036564 1:414619-414641 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
900058193 1:650373-650395 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
902301979 1:15508368-15508390 ATTTGGGGATTTTGTTAAAAGGG - Intronic
905567607 1:38978315-38978337 GTTGGGGTATCCTGTTTAAAGGG - Intergenic
906703096 1:47874068-47874090 GAGTGAGTAGCTTGTAAAAATGG + Intronic
908478654 1:64514394-64514416 ATATGGCTATCTAGTTAAAAAGG + Intronic
910216586 1:84850163-84850185 TTGTGGGTCTTTTGTTCAAAAGG - Intronic
911140806 1:94500481-94500503 GTTTGGGTACCTTGTCAAGAGGG + Intronic
911877456 1:103186367-103186389 GTGTTGGTATCTTGCTATTATGG - Intergenic
916698990 1:167271371-167271393 GTTCGGGTGTCTTGTTGAAAAGG - Intronic
916951672 1:169786566-169786588 GTGTGGGCATTTTTTTTAAAGGG - Intronic
917210471 1:172626798-172626820 GTGTGTGTGTGTTGTTAAATAGG - Intergenic
917802500 1:178583087-178583109 GTGTAGGTATTGTGTTAAATGGG - Intergenic
919196898 1:194297821-194297843 GTGTGGGTATCAGTTGAAAATGG - Intergenic
919281156 1:195490629-195490651 TTGTGGGTATCTAATTAAACTGG + Intergenic
922259106 1:223920157-223920179 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
922581604 1:226702514-226702536 CTGTGGCTATCTGGTTACAAAGG + Intronic
924130876 1:240906767-240906789 GTGTTGGGTTCTTGTTAAAGAGG - Intronic
924340296 1:243022907-243022929 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
924404885 1:243732260-243732282 GTGTGGGTATCTTGTGTGACTGG - Intronic
1062783124 10:235016-235038 CACTGGGGATCTTGTTAAAAAGG + Intronic
1066093544 10:32050399-32050421 GTGTTGTTATCCTGATAAAAAGG + Intronic
1066736203 10:38482699-38482721 GTGTGTGTATGTTGTTATAAAGG + Intergenic
1072252137 10:93590074-93590096 GTGTGGCTATCTTATTGAAGCGG + Intronic
1072313583 10:94180608-94180630 GTGTGGGTTTCATGTAAAATAGG - Intronic
1073329024 10:102658875-102658897 GTCTTGGGAGCTTGTTAAAAGGG + Intergenic
1073781302 10:106841463-106841485 GTGTGTGTATTTTATTGAAATGG - Intronic
1074040238 10:109781044-109781066 TTGTGGGTATCTTTTTGTAAGGG + Intergenic
1076785582 10:132748235-132748257 GTCTGGGTATTTTGTGTAAATGG + Intronic
1077536893 11:3128874-3128896 GTGTGGGTTTCATGATCAAACGG - Intronic
1078827671 11:14945818-14945840 GTGTGAGTAGATTTTTAAAAGGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1082795976 11:57378052-57378074 TCCTGGGGATCTTGTTAAAATGG + Intronic
1086988289 11:93273816-93273838 ACCTGGGGATCTTGTTAAAATGG - Intergenic
1087183730 11:95163286-95163308 GTGTGGGGATCTTGTAAAACGGG + Intergenic
1095178469 12:39120068-39120090 GGGTGGGGATGTTGTGAAAAGGG - Intergenic
1097545581 12:60996729-60996751 ATTTGGGGATGTTGTTAAAATGG - Intergenic
1099000413 12:77172333-77172355 GTGTGGGTATCATGAACAAAAGG - Intergenic
1100275163 12:93065128-93065150 GTGTGTGTATCTTTTTCTAATGG - Intergenic
1100932769 12:99629700-99629722 GAGTGGATAACTTATTAAAAAGG + Intronic
1102625653 12:114233377-114233399 GTGAGGGTATCTTGTACATATGG + Intergenic
1109069713 13:57749035-57749057 ATGTGGGTATCAAGTTAACAAGG + Intergenic
1111016147 13:82385024-82385046 TTTTGGTTTTCTTGTTAAAAGGG - Intergenic
1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG + Intergenic
1117527147 14:56620250-56620272 GTGTGGGTTTGTTGTTATAAAGG - Intronic
1118899117 14:69972105-69972127 CTGTCTGTATCTTTTTAAAAAGG - Intronic
1119532945 14:75375904-75375926 ACTTGGGTATCTTGTTAAGATGG - Intergenic
1120981346 14:90291991-90292013 GAGTTGGTATCTGGTTAAACTGG + Intronic
1121965274 14:98297689-98297711 TTGTGGGTAGCTTCTGAAAAAGG + Intergenic
1122048044 14:99037344-99037366 CTTTGGGTATCTTGTATAAATGG - Intergenic
1124160592 15:27265152-27265174 GAGTGGGTTTTTTGGTAAAATGG - Intronic
1124611305 15:31211122-31211144 TTGTGGTTATGTTTTTAAAAAGG + Intergenic
1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG + Intronic
1126416059 15:48418532-48418554 GTGTTTGTATATTGATAAAAAGG - Intronic
1127371599 15:58346556-58346578 TTGTGGGTATCATGTTGAGATGG + Intronic
1133919519 16:10139627-10139649 CTGGGGATACCTTGTTAAAAAGG + Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1135090060 16:19506821-19506843 TTGTGGCTATGTTTTTAAAAAGG + Intronic
1136127251 16:28193072-28193094 GTGTGGGTCTCCTTTTATAAAGG + Intronic
1140036981 16:71378601-71378623 ATCTGGGGATCTTGTTAAAATGG - Intronic
1140573828 16:76139755-76139777 GTGTGTCTGTTTTGTTAAAAAGG - Intergenic
1140819681 16:78651468-78651490 GTGTGAGCAGATTGTTAAAATGG + Intronic
1142453680 16:90202762-90202784 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
1146487214 17:33252835-33252857 CTGCGAGTATGTTGTTAAAATGG - Intronic
1149819795 17:59765190-59765212 GTGTGTGTACCTTATTGAAATGG + Intronic
1153999828 18:10473700-10473722 GAGTGGGTGTCTTGGGAAAATGG + Intronic
1154305308 18:13226341-13226363 GTTTGGGTAGATTCTTAAAAGGG + Intronic
1155215363 18:23638733-23638755 GTTTGAGAATCTTGTAAAAAGGG + Intronic
1156680489 18:39582670-39582692 ATGTGGGTTTCTTGCCAAAATGG - Intergenic
1158958684 18:62568294-62568316 GTTTGTGTGTCTTTTTAAAAGGG + Intronic
1159184214 18:64948406-64948428 CTGTGGCTATTTGGTTAAAAGGG + Intergenic
1159564251 18:70031292-70031314 ATGTGTGTACCTTATTAAAATGG + Intronic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1163383686 19:16985968-16985990 GTTTGGGTGTCTTTTTATAAGGG - Intronic
1166092760 19:40520833-40520855 GTTTGGGGATCATGTTAGAAAGG + Intronic
929983478 2:46701906-46701928 GTGTGGCGGTTTTGTTAAAATGG + Intronic
932392553 2:71409653-71409675 GGGTTTGTATCTTGTTGAAAGGG + Intronic
936656677 2:114496382-114496404 GACTGGGTATCTTGTAAATAAGG + Intronic
939291066 2:140195337-140195359 GTGTGTGTGTCTTGGTAAGAAGG - Intergenic
939639282 2:144619494-144619516 ATGAGGGTATATTGTTAAACAGG + Intergenic
942944446 2:181657343-181657365 GCTTGGGCATCTTGTTCAAATGG + Intronic
945164876 2:206932636-206932658 ACCTGGGGATCTTGTTAAAATGG + Intergenic
947767975 2:232649540-232649562 GTGTGGGCAGCTTGTTAGAGTGG + Intronic
949085126 2:242147422-242147444 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
1170174182 20:13449597-13449619 GTGTGGGAAGCTTGATAAAATGG + Intronic
1179099129 21:38341428-38341450 GTGTGGGTATCCTGTTGGAGAGG - Intergenic
1180317049 22:11284633-11284655 GTGTGGGTATTGTGAGAAAAAGG - Intergenic
1182185772 22:28400355-28400377 GTATTTGTATCTTTTTAAAAAGG - Intronic
1184147081 22:42617993-42618015 GTGTGGGGCTGTTCTTAAAACGG - Exonic
949387899 3:3524795-3524817 GTTTTGGTATCTTTTTAAAAGGG + Intergenic
949503565 3:4705030-4705052 GTGTGTGTATGTTTTTAAATGGG + Intronic
949858107 3:8480682-8480704 GTGAGGGTACCTTGTTGACACGG + Intergenic
951050832 3:18090862-18090884 GTGTGGGTATCTATTTATAGAGG + Intronic
957131606 3:76230124-76230146 GTGTGGGTATCAAGTTATTAGGG - Intronic
964181238 3:153888993-153889015 GTGTGTGTATCATGTTGAATGGG + Intergenic
964535850 3:157720203-157720225 TTGTGGGTCTGTGGTTAAAAGGG - Intergenic
965176748 3:165344793-165344815 GTGTGTGTGTCTTGGAAAAAGGG + Intergenic
966834161 3:184036621-184036643 GTGAGGGAATCTTGCTGAAAAGG + Intronic
967544612 3:190710130-190710152 TTGTGGGTATCATGTGAATAAGG + Intergenic
968436049 4:589925-589947 TTGTGGGGATATTTTTAAAATGG + Intergenic
969368445 4:6714706-6714728 GTGTGGTTAGCACGTTAAAATGG - Intergenic
969409416 4:7018345-7018367 GTGTGGGTAGCCCATTAAAATGG + Intronic
973100642 4:46264671-46264693 GTATTGGTATCTTGGTAATACGG + Intronic
974573855 4:63690345-63690367 GTGTGTGTGTCTTGTCAAACTGG - Intergenic
974937623 4:68426985-68427007 ATGTGGATATCCTGATAAAACGG + Intergenic
976035296 4:80811310-80811332 GTGTAGGTATCTTTTAAACATGG + Intronic
976829465 4:89298065-89298087 GTGTGGATATTTTCTTAAATAGG + Intronic
979262558 4:118665667-118665689 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
979731558 4:124029378-124029400 GTGTGTGTATTTTTTTAAACAGG + Intergenic
980085505 4:128386416-128386438 AAGTGGGGAACTTGTTAAAAGGG + Intergenic
982454268 4:155589465-155589487 GGCTGGGTTTCTTGATAAAAAGG - Intergenic
982636061 4:157898158-157898180 GTGTGGGAGGCATGTTAAAATGG + Intergenic
982897444 4:160950569-160950591 GTGTGGGGATTTTGTTAATTTGG - Intergenic
983951666 4:173649335-173649357 GTGTGTGTATTTTTTTTAAATGG - Intergenic
984658011 4:182340574-182340596 GAATGGGTATTTTGTTCAAATGG + Intronic
987085506 5:14463944-14463966 GTGCTGGTCTCGTGTTAAAAAGG - Intronic
992661358 5:78964246-78964268 GCCTGGGAAGCTTGTTAAAAAGG - Intronic
992817099 5:80453717-80453739 GTGTGTGTATTTTGTTACAGAGG + Intronic
994407968 5:99369535-99369557 GTGTGTGTATTTAGGTAAAAGGG + Intergenic
997178944 5:131808108-131808130 GCTTGAGGATCTTGTTAAAATGG - Intronic
999419065 5:151425299-151425321 ATGTGGGCATCTTGGTAAGAGGG - Intergenic
1000541109 5:162541400-162541422 CAGTTGGTATCTTGTTAGAAGGG + Intergenic
1001166155 5:169370197-169370219 GTGTGTGTAGCTTTTGAAAAAGG - Intergenic
1002737257 5:181404245-181404267 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
1004078847 6:12370852-12370874 ACCTGGGGATCTTGTTAAAATGG + Intergenic
1006644282 6:35505563-35505585 ATGTGGGGAGCTTGTTAAAATGG - Intronic
1007116178 6:39344948-39344970 GTGTGGGAATCTCCTTAGAAAGG + Intronic
1007834537 6:44664479-44664501 GTGTGGGCAGCTTTTTAGAAAGG + Intergenic
1009030310 6:58048961-58048983 TTGTGGGTATCTTGTAAAACAGG + Intergenic
1010541875 6:77101438-77101460 GTGTGAGTAGCTTCTTAAAAAGG - Intergenic
1011584148 6:88906342-88906364 GTATTTGTATCTTGTTATAATGG - Intronic
1012635661 6:101536986-101537008 GTGTTGGTTTCTTGTAGAAATGG + Intronic
1013430313 6:110049612-110049634 GAGTGGCTATCTTGTTGGAAAGG + Intergenic
1014032823 6:116725963-116725985 TTTTCGGTATCTTTTTAAAAAGG - Intronic
1014035411 6:116761956-116761978 GGGTGAGTATCTCCTTAAAAGGG - Exonic
1014756829 6:125310530-125310552 GTGAGGGAATCTTGTTTTAAAGG - Intergenic
1015542262 6:134326848-134326870 GTGTGTGTTTCTTCTTATAAGGG + Intergenic
1019242352 6:170679801-170679823 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
1022075532 7:26965715-26965737 GTGCTGGTATATTGTTATAATGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1025778642 7:64580037-64580059 GTGTGTGTGTCTTTTTTAAATGG + Intergenic
1026131104 7:67621663-67621685 GGGTGGCTTTTTTGTTAAAAGGG - Intergenic
1028253509 7:88563935-88563957 CTGTGGGTATGTTCTCAAAATGG - Intergenic
1035505765 8:128353-128375 GTGTGTGTGTGTTGTTATAAAGG - Intergenic
1035975838 8:4310339-4310361 GAATGGGTATCTTGGTCAAAGGG + Intronic
1037953347 8:23033846-23033868 GTCTGGGTCTTTTCTTAAAAAGG + Intronic
1039283608 8:36013708-36013730 GTGTTGTTATTTTGTTTAAATGG - Intergenic
1039601554 8:38842534-38842556 TTGTGGGTATCCTTTTAAATAGG + Intronic
1040795858 8:51289537-51289559 GTTGGGGTATCTTGTTTAGAGGG - Intergenic
1042458342 8:69031807-69031829 GTGTGGGTATCATGTTCCAGGGG - Intergenic
1042737778 8:72008121-72008143 GTGTGGGTGTTTTATTAAAGAGG - Intronic
1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG + Intronic
1043374627 8:79634849-79634871 GAGTGGGTATCTTGGGAAAGAGG - Intronic
1044317419 8:90765917-90765939 ATCTGGGTATCTTGTTTGAAGGG + Intronic
1045613979 8:103884441-103884463 GTGTGAATATTTTGTTAACAGGG + Intronic
1050441622 9:5669931-5669953 GTGTGGGGGTCTTGCTAAACTGG + Intronic
1052174726 9:25444172-25444194 CTGTTGGTATGTTGTAAAAAAGG + Intergenic
1053405234 9:37868927-37868949 GTGTGGTTAACCTGTTTAAAAGG + Intronic
1055101225 9:72467608-72467630 GAGTGGATAACTTGTTAAAAAGG - Intergenic
1055366422 9:75549186-75549208 GTGTGGATATCTCAATAAAAGGG - Intergenic
1055522764 9:77098306-77098328 TTTTGTGTATCTTTTTAAAATGG + Intergenic
1057931143 9:99194348-99194370 TTGTGGGTATTTTTTGAAAATGG + Intergenic
1058347399 9:103980328-103980350 TTGTTGGTATCGTCTTAAAATGG - Intergenic
1203602543 Un_KI270748v1:29025-29047 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
1185714754 X:2332283-2332305 GTGTGGGTAGCTCGTAAGAAAGG + Intronic
1185964282 X:4582671-4582693 GTGTGTGTGTATTGTTTAAAAGG + Intergenic
1186303834 X:8232079-8232101 GTGTGGGTTTCTTATTTAATTGG - Intergenic
1186494690 X:10002746-10002768 GTGTGTGTATGTTTTTGAAACGG - Intergenic
1186537720 X:10367155-10367177 GTGGGAGAATCTTGTAAAAATGG + Intergenic
1191996785 X:67104358-67104380 GAGTGGGTAGCTTGTTACAGAGG - Intergenic
1194067901 X:89284560-89284582 GAGAGGGGATCTTCTTAAAAAGG + Intergenic
1197039339 X:121917267-121917289 GTCTCGGTTTCTTCTTAAAAAGG - Intergenic
1197078743 X:122386281-122386303 GTGTGGGGTCCCTGTTAAAAAGG - Intergenic
1198045013 X:132892812-132892834 GTTTGGGTTTCTTTTTAAGATGG - Intronic
1198552698 X:137761261-137761283 ACCTGGGGATCTTGTTAAAAGGG + Intergenic
1200722046 Y:6618721-6618743 GAGAGGGGATCTTCTTAAAAAGG + Intergenic
1201272500 Y:12268590-12268612 GTGTGTGAATTTTTTTAAAAAGG - Intergenic
1202193073 Y:22264430-22264452 GTGTGGGTACCTTGTTTACATGG - Intergenic
1202384628 Y:24314123-24314145 GTGTGTGTGTGTTGTTATAAAGG + Intergenic
1202486156 Y:25355999-25356021 GTGTGTGTGTGTTGTTATAAAGG - Intergenic