ID: 1124829374

View in Genome Browser
Species Human (GRCh38)
Location 15:33133138-33133160
Sequence CAGTTAACTCACAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124829366_1124829374 24 Left 1124829366 15:33133091-33133113 CCTCCCACATCAGGCACCATCAC 0: 1
1: 0
2: 0
3: 26
4: 239
Right 1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1124829367_1124829374 21 Left 1124829367 15:33133094-33133116 CCCACATCAGGCACCATCACTAC 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1124829369_1124829374 8 Left 1124829369 15:33133107-33133129 CCATCACTACATAGAACTGTGTG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1124829368_1124829374 20 Left 1124829368 15:33133095-33133117 CCACATCAGGCACCATCACTACA 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG 0: 1
1: 0
2: 0
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124829374 Original CRISPR CAGTTAACTCACAAGGAAGA GGG Intronic
902842393 1:19083308-19083330 CTTTTAACTCACAAGGAAATGGG + Intronic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
905758427 1:40532244-40532266 CAGTTAACTCATATGCAAAATGG - Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
908736980 1:67286715-67286737 CAGATAACTCAAAAGAAAAATGG - Intergenic
910087238 1:83418117-83418139 CAGTTAACTTACAATCATGATGG + Intergenic
910686245 1:89919501-89919523 CAGTAAACTTAAAAGGAAAATGG + Intronic
911467374 1:98272531-98272553 CAGTTTCCTCACAAGGTGGAAGG - Intergenic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
912039307 1:105367136-105367158 CAATTTAATCACATGGAAGAGGG - Intergenic
914723150 1:150305969-150305991 CAATTAAATCACAAAGGAGAGGG - Intronic
917080928 1:171256310-171256332 CAGTTTACTCACTCGCAAGATGG - Intronic
917505197 1:175621082-175621104 CAGTTAACAGTCAAGGACGATGG - Intronic
920620371 1:207540500-207540522 CAAACAACTCACAGGGAAGATGG - Intronic
920622153 1:207559057-207559079 CAAACAACTCACAGGGAAGATGG - Intronic
920623762 1:207576108-207576130 CAAACAACTCACAGGGAAGATGG - Intronic
920636399 1:207708690-207708712 CAAACAACTCACAGGGAAGATGG - Intronic
922610748 1:226925229-226925251 CTGTATACTCACAAGGAAGTGGG + Intronic
923694212 1:236230843-236230865 CAGTTAACTCAGAAGGTTGAGGG + Intronic
924158307 1:241204226-241204248 CAGTCAACACCCAAGGAGGAGGG + Intronic
924214720 1:241809270-241809292 CATTTACCTCACACGGAAAAGGG + Intergenic
924271028 1:242332924-242332946 CAGGTACCTCACAGGGAACAAGG + Intronic
924453758 1:244201566-244201588 CAGTTGAGTCACAAAGAACACGG + Intergenic
1064166056 10:12987212-12987234 CAATTAACCCACATGAAAGATGG - Intronic
1064815332 10:19254884-19254906 CAGTTAACTCATAAGAGAAATGG - Intronic
1065148789 10:22800416-22800438 GAGTTAAGTCACAAGAAACAAGG - Intergenic
1065154014 10:22851276-22851298 CATTTAACTCACAAGGAGACAGG - Intergenic
1065402707 10:25324108-25324130 CAGTAAACACACAAATAAGAAGG - Intronic
1066017663 10:31264210-31264232 CAGTCAATCCACAAGGAAGAGGG - Intergenic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1068681908 10:59829133-59829155 CAGTTAACTCACATGTCAGCAGG - Intronic
1069897806 10:71689695-71689717 CAGCAAACTCACAAGTTAGAGGG + Intronic
1069899029 10:71696396-71696418 CTGTAATCTCACAAGGCAGAGGG + Intronic
1070454514 10:76598991-76599013 CAGCTAGCACATAAGGAAGAGGG - Intergenic
1073999737 10:109358718-109358740 AATTTAAATCACAAGGAAGAAGG + Intergenic
1075930358 10:126289834-126289856 CAGTTTTCTTACAAGGAAAATGG + Intronic
1077004039 11:342735-342757 CAGTTAATTGACAATGAAAAAGG - Intergenic
1078950207 11:16123307-16123329 CAGTTTCATCACAAGCAAGAAGG + Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079313056 11:19383189-19383211 CAGTTAACTGTAAAGGAAGCAGG - Intronic
1079607956 11:22393330-22393352 CAGCTACCACACCAGGAAGAAGG - Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079967041 11:26992622-26992644 CAGTTACATTTCAAGGAAGAAGG + Intergenic
1080503325 11:32890144-32890166 CAATAAACTCAGAAGGAAGTGGG - Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1081778029 11:45689892-45689914 CAAATAACTCACAAGGTATAAGG - Intergenic
1081905450 11:46666657-46666679 CAGTTAGCTCACAGGGCACAAGG + Intronic
1084566922 11:69935127-69935149 CATTTCACTCACATGGAAAAGGG + Intergenic
1085790356 11:79492328-79492350 TGATTAACTCACAAGGAAAAGGG + Intergenic
1087259831 11:95998785-95998807 AAGTAAGCTCACAAGGAAGCTGG + Intronic
1088347849 11:108849282-108849304 CAGCTATCACATAAGGAAGAAGG - Intronic
1088550895 11:111011284-111011306 CACTTAAGTTTCAAGGAAGATGG + Intergenic
1089413653 11:118268214-118268236 CAGTTATCTCACATGTAAAATGG + Intergenic
1090428089 11:126624124-126624146 CAGGCAACTAACAAGGAAAATGG + Intronic
1091141033 11:133234944-133234966 GAGGTACCACACAAGGAAGATGG + Intronic
1092165995 12:6342599-6342621 CAGTAAATTCCCAAGAAAGAGGG - Intergenic
1092896050 12:13011351-13011373 GAGTTTACTGAGAAGGAAGAAGG + Intergenic
1093840937 12:23899996-23900018 CAGTTGACTTTCAAGGAAAAAGG + Intronic
1094112280 12:26874376-26874398 CCATTAACTCACCAGGAATAAGG - Intergenic
1094214266 12:27923748-27923770 AAGTGTATTCACAAGGAAGATGG + Intergenic
1094232515 12:28123061-28123083 TAGTTACCTCAGTAGGAAGAAGG - Intergenic
1094633935 12:32205301-32205323 TAGTTAACTCAGAATGGAGATGG + Intronic
1095751650 12:45719230-45719252 CTGTAACCTCACAAGGCAGAAGG + Intergenic
1096426351 12:51507045-51507067 CAGTTTACTCAGCAGGAAAATGG + Intronic
1099847351 12:88044703-88044725 AAGTCAGCTGACAAGGAAGAGGG + Intronic
1100656569 12:96652547-96652569 CAGTTAACTCAAAAGAAGGCAGG + Intronic
1102421154 12:112803894-112803916 CAGTTTACTCACCTGTAAGATGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1103408287 12:120691519-120691541 CAGTTAACCAAAAAGGAAGGGGG - Intronic
1103434263 12:120912750-120912772 CAGTTAACTCAAAAGAAGGTAGG - Intergenic
1103700426 12:122846337-122846359 CAGTTTCCTCACCAGGAAAATGG + Intronic
1105872509 13:24518033-24518055 CAATTAACTCACTTGTAAGATGG - Intergenic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1110012705 13:70357835-70357857 CAATTAACTCATAACAAAGAAGG - Intergenic
1111408734 13:87845774-87845796 CTGTCATCTCACAAGGCAGAGGG - Intergenic
1113331713 13:109333864-109333886 TAGATAACTCATTAGGAAGAAGG - Intergenic
1115055731 14:29124172-29124194 CAGTAAATGCACAAGGAAAAAGG + Intergenic
1115738811 14:36365069-36365091 AAGTTAACTGAAAATGAAGAGGG - Intergenic
1115855582 14:37626354-37626376 CATATAACTCAAAAGGAAAACGG + Intronic
1116637836 14:47419821-47419843 CAATTAGCTCACAAGAAAAATGG - Intronic
1117187175 14:53252005-53252027 CAGTAAACTCATAAGCCAGAAGG - Intergenic
1118374223 14:65162875-65162897 TGTGTAACTCACAAGGAAGAAGG - Intergenic
1119317263 14:73706021-73706043 CAGGTAACTCTCACGGTAGAAGG + Intergenic
1119888354 14:78163599-78163621 CAGTTACCTCACATGTCAGATGG + Intergenic
1119993890 14:79230487-79230509 TGGCTAACTCACAAGGTAGAAGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120442740 14:84560264-84560286 CAGCTAAGTCAGCAGGAAGAGGG - Intergenic
1121687008 14:95843168-95843190 CAGATAATTCACAAGGATAAAGG + Intergenic
1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG + Intronic
1124852368 15:33352881-33352903 CACTTAACACACGAGGACGATGG + Intronic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1130223459 15:82040753-82040775 AAATTAACACAAAAGGAAGAAGG + Intergenic
1130891443 15:88137118-88137140 CAGGTAACTCACAGGGAGAAAGG + Intronic
1131728574 15:95254227-95254249 CATTTAACTGACAAGAAAGTAGG + Intergenic
1131997436 15:98145829-98145851 CAATTAACCCACAAGGAAATTGG + Intergenic
1136639303 16:31549042-31549064 CAATAAAATCACAAGGCAGAGGG + Intergenic
1140778273 16:78270665-78270687 TCATTAACTTACAAGGAAGAGGG + Intronic
1140844354 16:78872281-78872303 CAGTTTTCTCATAAGAAAGATGG + Intronic
1141196992 16:81867490-81867512 CAGTTTCCTCACCTGGAAGATGG + Intronic
1142331015 16:89453913-89453935 CAGTTGAGGCACAAGGAAGTTGG - Intronic
1146412055 17:32594886-32594908 CAGTGAGCTGACAAGGAAGCAGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146756975 17:35441474-35441496 CACTCAATTCTCAAGGAAGAAGG + Intronic
1147832803 17:43308838-43308860 CAGTTCACTCACCAGCAAAATGG + Intergenic
1148445401 17:47734150-47734172 CAGAGGACTCACAAGGGAGACGG + Intronic
1148659570 17:49318046-49318068 CATTTAAATCACAAGAAACAGGG + Intronic
1148659787 17:49320252-49320274 GAATAAACTCACAAGGAAAAAGG - Intronic
1149879721 17:60276996-60277018 CAGCTAAATTACTAGGAAGAGGG + Intronic
1150850474 17:68699238-68699260 TAGTTATCTCACAAGGAAACAGG - Intergenic
1150917161 17:69448684-69448706 CAGTTCACTGACCAGGGAGAAGG - Intronic
1152411331 17:80124832-80124854 CAGCTGCCTCACAAGGAAGAGGG + Intergenic
1152926229 17:83089023-83089045 CAGCTTCCTCACCAGGAAGAGGG + Intronic
1153896356 18:9565566-9565588 CAGTGAACACACAAAGAAGAAGG + Intronic
1155213623 18:23623211-23623233 CAGTTATCTCACAGGGTCGATGG - Intronic
1155990328 18:32272965-32272987 CAGTTCACTAACAAGACAGAAGG - Intronic
1156195066 18:34765474-34765496 CAGTTTTCTCACTTGGAAGATGG - Intronic
1156524709 18:37756020-37756042 CAGCTAATTCAACAGGAAGATGG + Intergenic
1157144060 18:45143112-45143134 CTGTTGACTCACAAGAAAGATGG - Intergenic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1159218058 18:65422900-65422922 CATTTAGCTCCCAAAGAAGACGG - Intergenic
1159343208 18:67163787-67163809 CAGTTAGGGCACAAGCAAGATGG + Intergenic
1160354295 18:78214011-78214033 CATTTAACTCAGAACGAACAAGG - Intergenic
1163222190 19:15929582-15929604 CAGGTCACTCCCACGGAAGAGGG - Exonic
1163745765 19:19045997-19046019 CAGATACCTCACCAGCAAGATGG - Intronic
1164403805 19:27923867-27923889 CAGTTAATGGACAAGCAAGAAGG + Intergenic
1165920455 19:39294410-39294432 CAGTTATCTCACTAGTAAAATGG + Intergenic
1166606165 19:44144760-44144782 AAGTCAACTCAAAAGGCAGAAGG - Intronic
1168352502 19:55684746-55684768 TAGTTAAATCACAATGAAGGGGG - Intronic
925819304 2:7784024-7784046 CAGTTAATTTACTGGGAAGAAGG + Intergenic
926066836 2:9847536-9847558 CAGTTACATGCCAAGGAAGAGGG - Intronic
926093024 2:10062764-10062786 CAGTTTACTCACTAGGAAAATGG + Intronic
926421136 2:12700691-12700713 CAGTGACCCCACAAGAAAGATGG + Intergenic
927409679 2:22809862-22809884 AAGTAAACACACAAGCAAGAAGG + Intergenic
927409707 2:22810444-22810466 AAGTAAACACACAAGGAAGAAGG - Intergenic
929354597 2:41005303-41005325 CAAATAAATGACAAGGAAGAAGG - Intergenic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
932161912 2:69468213-69468235 CACATAAATCGCAAGGAAGAAGG - Exonic
932516777 2:72359356-72359378 CTGTGATCTCACAAGGTAGAAGG - Intronic
933092063 2:78133614-78133636 CAGTTGACTCACAAACAACAAGG - Intergenic
933171665 2:79132246-79132268 CTTTTATCTCACAAGAAAGATGG + Intergenic
935375820 2:102396213-102396235 CATTTAACAAACAAGGAAGCCGG - Intronic
935548284 2:104423894-104423916 CAGAAAACGCATAAGGAAGAAGG - Intergenic
936687684 2:114847393-114847415 CAATTAGGGCACAAGGAAGAAGG - Intronic
938978484 2:136502907-136502929 CAATCAAGTCACAAGGCAGAAGG - Intergenic
940172646 2:150845503-150845525 CAGATTACTCACAACAAAGAGGG + Intergenic
940479044 2:154204861-154204883 CAGCTAACTCTCAATGAAGAGGG - Intronic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
942515227 2:176745658-176745680 CAGAAAACTGAAAAGGAAGAGGG + Intergenic
943308566 2:186298254-186298276 CACTTTCCTCACAAGGAGGAAGG - Intergenic
944320699 2:198338633-198338655 CAGTCAATTCACATAGAAGAAGG + Intronic
947900956 2:233721017-233721039 CAATTCTCTCACAAGAAAGATGG - Intronic
1169398821 20:5261936-5261958 CAGTTAATCCACAAGGAAGTGGG - Intergenic
1169752727 20:9011252-9011274 CATTAAACTCACTATGAAGATGG + Intergenic
1174962383 20:55173075-55173097 CAGTTTACTGATAAGTAAGAAGG - Intergenic
1177650826 21:23960252-23960274 CAGTAAACTAACAAGGATAAAGG - Intergenic
1178055116 21:28789985-28790007 AAGTTAACTCACAAGGCAGTGGG - Intergenic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1179557313 21:42187990-42188012 CAGTTACCTCACCTGGAAAATGG + Intergenic
1182237978 22:28891532-28891554 CATTTAACAGACAAGGTAGATGG + Intronic
949858076 3:8480393-8480415 CAGTGAAGCCACAAGGCAGAGGG - Intergenic
950982039 3:17317325-17317347 CAGGTAACTCACAAGAAGGCAGG + Intronic
950987512 3:17390945-17390967 CAGCTAACTGAAAAGGAAGCTGG - Intronic
952504201 3:33993047-33993069 CAGTTAAGTCACAAGGAATGGGG - Intergenic
953298689 3:41749919-41749941 CAGTAAACTGTCAATGAAGAAGG + Intronic
955321099 3:57974917-57974939 CAGATAACTCACAGGAAGGAAGG + Intergenic
955466598 3:59243426-59243448 CACTGACCTCACAAGGCAGAAGG - Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
958431898 3:94049512-94049534 CAATTTACTCACCAGGAGGAGGG - Exonic
959021481 3:101192067-101192089 AAGTTAGGTTACAAGGAAGAAGG - Intergenic
960242255 3:115358863-115358885 CTGTTAAATCTCAAGGAATAAGG + Intergenic
961372339 3:126439348-126439370 CAGTTAATTCTCTGGGAAGAGGG - Intronic
961706041 3:128786022-128786044 CAGTAGTCTGACAAGGAAGAAGG - Intronic
962422656 3:135241808-135241830 GAGTGAATTCTCAAGGAAGAAGG - Intronic
962746871 3:138403403-138403425 CAGTTGACTCCAAGGGAAGATGG - Exonic
964394278 3:156229018-156229040 CCCTTTACACACAAGGAAGAGGG - Intronic
966495301 3:180573400-180573422 CTCATATCTCACAAGGAAGAGGG + Intergenic
967275401 3:187769231-187769253 CAGATAACTCAGCAGGCAGATGG + Intergenic
967744129 3:193035928-193035950 CAGTTAACTCTCGAGCAACATGG + Intergenic
969431370 4:7156753-7156775 CTGTTAGCTCGCAAGGCAGAAGG + Intergenic
969844333 4:9908223-9908245 CAGTTGACTTACAGAGAAGACGG + Exonic
970531409 4:16989230-16989252 CAGTTAACTTAGAAGAAGGAAGG - Intergenic
971259257 4:25041544-25041566 CAGTTAATTTATAAGGAAAATGG - Intergenic
971932861 4:33107517-33107539 GAGTTAACTGATGAGGAAGATGG - Intergenic
972160978 4:36227192-36227214 CAGTTACCTCAAAAGTAAAATGG + Intronic
972464591 4:39342976-39342998 CAGTGTAGTCACAAGGAATAGGG - Intronic
974225391 4:59036280-59036302 CAGTTAACACAGAAAGAAAAGGG - Intergenic
974229420 4:59091384-59091406 CCGTTAACTCAGTAGGAAGTGGG - Intergenic
977408967 4:96636912-96636934 CAGCTAATTCACAAAGCAGAGGG - Intergenic
978468645 4:109037234-109037256 CAGCTAACTCATGAGAAAGAAGG - Intronic
981408401 4:144398431-144398453 CAATTAACTCAGGAGGAGGAAGG + Intergenic
983221518 4:165048383-165048405 CAGTTAACTTGATAGGAAGAGGG - Intergenic
984676472 4:182553800-182553822 AAGTTAAATCACAACGCAGATGG - Intronic
985220001 4:187694019-187694041 CGGTTAATTAACAAGGATGAAGG - Intergenic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
986914047 5:12594707-12594729 CAGGAAACTGACAAGGCAGAAGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989238827 5:39180221-39180243 CCGTTAATACACTAGGAAGAAGG - Intronic
989299867 5:39878145-39878167 CAGAGAACTAACAATGAAGAAGG + Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
991166357 5:63568364-63568386 CAGCTAAATCAGAAGGGAGAGGG + Intergenic
993866948 5:93207033-93207055 CAGGTTACCCACAAGGAAAAGGG + Intergenic
994171903 5:96667159-96667181 CAGTTAACTCAGGAAGAAAAAGG + Intronic
994411651 5:99414138-99414160 CAGTACACTCACATGGAGGAAGG + Intergenic
994482174 5:100351112-100351134 CAGTACACTCACATGGAGGAAGG - Intergenic
995550645 5:113277821-113277843 CTGTTCACTCACAATGCAGATGG - Intronic
999343300 5:150792361-150792383 CAGTGAACTCACTAGAAGGAGGG + Intronic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1004452470 6:15759328-15759350 CAGCTGACACACAAAGAAGAAGG + Intergenic
1005107154 6:22236078-22236100 GAGTTAAGTCAAGAGGAAGATGG + Intergenic
1005756145 6:28926408-28926430 CAGTAAACACTCAAGGAAGAGGG - Intergenic
1006585125 6:35105103-35105125 CAGGTAACTCACAAAGAAGCAGG + Intergenic
1006703663 6:35997894-35997916 CAGAGCACTCACCAGGAAGAAGG + Exonic
1006825205 6:36929631-36929653 CAGTTACCTGACTAGGAAAAGGG - Intergenic
1007068660 6:39018625-39018647 CAGATGACTCAGGAGGAAGATGG - Intronic
1007606240 6:43120111-43120133 CAGTTTTCTCACTTGGAAGATGG - Intronic
1008093907 6:47319214-47319236 CAGTTTACTCAAAAGGCAGTGGG + Intergenic
1008417583 6:51260998-51261020 TAATTATCTCACATGGAAGATGG + Intergenic
1010029665 6:71259878-71259900 CAGTTAACTCTCAAGGTAGCTGG - Intergenic
1010158398 6:72822429-72822451 CAGATAACACATAAGGAATAGGG - Intronic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1013662604 6:112313406-112313428 CAGTTATTTTACAAGGGAGAGGG - Intergenic
1013705808 6:112832727-112832749 CAGTTATCTATCAAGGGAGATGG - Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014224313 6:118830610-118830632 CATTTAACCCACACTGAAGACGG + Intronic
1014470224 6:121804023-121804045 CAGTTACCTAAGAAAGAAGAAGG - Intergenic
1014499425 6:122166645-122166667 CAGATAAATCAAAAGAAAGATGG + Intergenic
1014696578 6:124628958-124628980 CAGCTAGCTCAAAAGTAAGAGGG + Intronic
1016098362 6:140065999-140066021 CAGGTAACTCAGAAAAAAGAAGG + Intergenic
1016189867 6:141251733-141251755 AAGTTAACCCACTAGAAAGATGG + Intergenic
1016714838 6:147212941-147212963 CATTTAACAACCAAGGAAGAAGG - Intronic
1019131212 6:169877440-169877462 CATTTAACTAAAAAGGAAGACGG - Intergenic
1021518711 7:21516838-21516860 AAGTTAACCCAAAAGGCAGACGG + Intergenic
1024374871 7:48625813-48625835 CTTTTCACTCACAATGAAGATGG + Intronic
1027304113 7:76874601-76874623 CAGTTAACTTACAATCATGATGG + Intergenic
1031483849 7:122306252-122306274 GGGTTAACTCACCAGGCAGATGG - Intronic
1032447198 7:131994565-131994587 CAGTTAACTCCCTAGTCAGATGG + Intergenic
1033006511 7:137570455-137570477 CATTTTACTCATAAGTAAGACGG + Intronic
1033192109 7:139290766-139290788 CAGTTAAAGAACCAGGAAGAAGG + Intronic
1033946113 7:146720142-146720164 CAGTTATTTCACAAGAAAGAAGG + Intronic
1034136378 7:148774349-148774371 CAGTACACTCACAAGGAAATAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1037375792 8:18226280-18226302 CAGTTAACCACAAAGGAAGATGG + Intergenic
1037449485 8:19002287-19002309 CCAGCAACTCACAAGGAAGACGG - Intronic
1038620620 8:29139477-29139499 CAGTTACTTCACTAGGAAGGGGG - Intronic
1039105369 8:33983856-33983878 CAGTTCCCTCACAAGTAAAATGG - Intergenic
1040462333 8:47660865-47660887 CAGTTAACTGACAAGAAAATAGG - Intronic
1043637322 8:82402351-82402373 CATTTAAATTACAAGGAATAGGG + Intergenic
1046279207 8:112003281-112003303 CAGTCAACTCACAAGGAAACAGG + Intergenic
1047801736 8:128317218-128317240 CACTTTACTCTCAAGGAAGGTGG + Intergenic
1050155213 9:2659781-2659803 CAGTTAACACACATGCAAGGAGG + Exonic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1051963955 9:22803194-22803216 CTGTTTGCTCACAAGGCAGAAGG + Intergenic
1055378079 9:75672535-75672557 CACATAACTCACAAAGAAAATGG + Intergenic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1055802922 9:80060253-80060275 CAGGTTTCTCACAAGGCAGATGG + Intergenic
1057643046 9:96846007-96846029 CAGAAACCTCACAAGAAAGAAGG + Intronic
1057906085 9:98984507-98984529 CAGTTTTCTCAGAAGTAAGATGG + Intronic
1057991822 9:99778430-99778452 AAGATGACTCACAAGGAAGGGGG - Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1060488012 9:124061777-124061799 CAGTTACCTCATCTGGAAGATGG + Intergenic
1060902926 9:127276920-127276942 CAGTTAACTCATCTGTAAGATGG - Intronic
1061060366 9:128247203-128247225 CAGTTTCCTCACTGGGAAGATGG - Intronic
1187179602 X:16931522-16931544 CAGTTAACTCACACGGATATTGG - Intergenic
1188004286 X:25006602-25006624 CACTTGAGTGACAAGGAAGATGG + Intronic
1188082783 X:25864633-25864655 CATTTAACTGCTAAGGAAGATGG - Intergenic
1189573987 X:42330295-42330317 CAGATAGATCACAATGAAGAAGG + Intergenic
1189992270 X:46606783-46606805 AATTTAACTCACAATGCAGATGG - Exonic
1191842729 X:65524689-65524711 CAGCTAAATCACAACGAACATGG + Intronic
1191875182 X:65788348-65788370 CAGCTGACTCAGAAGCAAGACGG + Intergenic
1193408662 X:81136306-81136328 CTATAAACTCACAAGGAAAAAGG - Intronic
1193519317 X:82509936-82509958 CAGACATCTCACAAGGAAGAAGG + Intergenic
1194897576 X:99464059-99464081 CAGTTAACCCAGAAGGAATGTGG - Intergenic
1199826988 X:151510140-151510162 CATTTATTTCACTAGGAAGAGGG - Intergenic
1200216319 X:154369620-154369642 CAGCCAGCTCACAAGGAGGAGGG + Intronic