ID: 1124830329

View in Genome Browser
Species Human (GRCh38)
Location 15:33142564-33142586
Sequence AGATCTTTACAGATGGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124830329_1124830333 5 Left 1124830329 15:33142564-33142586 CCATAACCCATCTGTAAAGATCT 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1124830333 15:33142592-33142614 TGCTAGGTAATATTAATAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124830329 Original CRISPR AGATCTTTACAGATGGGTTA TGG (reversed) Intronic
902106944 1:14045458-14045480 TGATCCTTACAATTGGGTTATGG - Intergenic
904514386 1:31042576-31042598 AGCTCTTAACAGATGGTATAAGG + Intronic
909207146 1:72773473-72773495 AGAGCATTACACATGGGTTGTGG + Intergenic
909482259 1:76138831-76138853 AGATCTTTACAAACTGGTTTTGG - Intronic
911390892 1:97240889-97240911 ACATCTTTACACATGGATTAGGG + Intronic
916698228 1:167262760-167262782 GGATTTTGACAGGTGGGTTAAGG + Intronic
917084657 1:171293422-171293444 AGATTTGTACAGAAGGGTCATGG + Intergenic
917818777 1:178739038-178739060 AAATCTTTATAGATAGTTTAGGG + Intronic
919271295 1:195350441-195350463 AAATCTTTAAAGATGTGTTAAGG - Intergenic
924689944 1:246337773-246337795 AGGTTTTAACAGAGGGGTTATGG - Intronic
1065388421 10:25157066-25157088 AGATCTTTCCAGAGTGGTTGAGG + Intergenic
1065635047 10:27723366-27723388 AAATCTATCCAGATGGGTCAAGG - Intronic
1065681547 10:28238967-28238989 AGATTTTTACATTTGGGTTGAGG + Intronic
1065853093 10:29806898-29806920 AGAACTTTACACATGACTTATGG + Intergenic
1065953388 10:30672744-30672766 AGAACTTTACAAATGGCTGAGGG - Intergenic
1067835266 10:49634410-49634432 AGATTTTTCCAGAGGGGTTGTGG - Intronic
1078958094 11:16226666-16226688 ACATAGATACAGATGGGTTATGG + Intronic
1079597033 11:22262680-22262702 AGTTCTTTATATCTGGGTTAGGG - Intronic
1080444253 11:32323172-32323194 TAATCTTCACAGATGGATTATGG + Intergenic
1081696205 11:45110754-45110776 ACACCTTTACAAATGGGTGAGGG - Intronic
1081704691 11:45174839-45174861 AGATCTGTACACATGGGTCTGGG - Intronic
1086345131 11:85888445-85888467 AGATATGAACAGATGGTTTATGG - Intronic
1086579922 11:88387351-88387373 AGATATTTACATATGAATTAGGG - Intergenic
1087989236 11:104727897-104727919 AGATCTTTACAGTAGGGTGGTGG - Intergenic
1088122218 11:106383747-106383769 AAATCTTTGCAGATTGGTTTTGG + Intergenic
1089356156 11:117855360-117855382 AGATTTTTAAAAATGGGTTTAGG - Intronic
1095310658 12:40693106-40693128 AGATCTTAACAGAGGGGTCAGGG - Intronic
1102483739 12:113242216-113242238 GAATGTTTGCAGATGGGTTAGGG + Intronic
1103851055 12:123934029-123934051 AGCTCTTTTGAGATGGCTTAAGG + Intronic
1104139029 12:125968842-125968864 AGATCTGGACAGATGGGATGAGG - Intergenic
1104359677 12:128121026-128121048 ACATTTTTACCCATGGGTTACGG - Intergenic
1106567861 13:30902149-30902171 AAATCTTTGCAGTTGGGGTAGGG - Intergenic
1106875906 13:34072618-34072640 AGAACTTTGCACAAGGGTTAGGG - Intergenic
1106897013 13:34314346-34314368 AGATGGTTAAAGATGGATTAAGG - Intergenic
1107104163 13:36625806-36625828 TGTTCTTTCAAGATGGGTTATGG - Intergenic
1107273596 13:38650684-38650706 AAATCTTTACAAATAGGTTAGGG - Intergenic
1107290212 13:38843376-38843398 AGATCTTTGTAGATCAGTTATGG - Intronic
1107374476 13:39787016-39787038 AGAAATTTACAGATGGGAAATGG + Intronic
1110326562 13:74223070-74223092 AGATGTTTACAGAAGGGAAAAGG - Intergenic
1112155476 13:96812178-96812200 AAAACTTTACAGATGGCTTGGGG + Intronic
1112196049 13:97227420-97227442 AGATATTTACAAATGAGATAAGG + Intronic
1119110678 14:71971077-71971099 AGAGCTAGACAGATGGATTAGGG + Intronic
1122783910 14:104155249-104155271 AGAACCTTACAGATGCGTTTGGG + Intronic
1123483006 15:20652915-20652937 TGATCTTTACAGATTTTTTAAGG + Intergenic
1124830329 15:33142564-33142586 AGATCTTTACAGATGGGTTATGG - Intronic
1127548798 15:60016649-60016671 ACATCTTTAAAGATGGGGTGGGG - Intronic
1127898904 15:63326802-63326824 AGATCTTTACATATGCTTTTTGG - Intronic
1127991722 15:64123846-64123868 AGATTTTAAAAGATGGTTTAGGG - Intronic
1128526963 15:68419087-68419109 AGACCTTTTCAGATGGGTGTGGG - Intronic
1129695235 15:77737183-77737205 AGATCAGTACAGATGTTTTATGG - Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1134451847 16:14368535-14368557 TATTCTTTACAGATGGGGTAAGG - Intergenic
1135384772 16:22028481-22028503 AGAGCTTTACAGATGGATCGGGG - Intronic
1138326436 16:56174912-56174934 AGAACTTTACAGATGTGATCAGG - Intergenic
1142693545 17:1621166-1621188 AGATCTTTACAGAGGAATCAGGG + Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1156244041 18:35280521-35280543 AGATCTTTAAAGTTGAGTTCAGG - Intronic
1159427683 18:68310654-68310676 AAATCTTTACAGAGGTGTTTTGG - Intergenic
1163055065 19:14711864-14711886 AGCTGGTTACAGATGGGTAAGGG + Intronic
1164239072 19:23367847-23367869 AGATTTTCACATATGGTTTAAGG - Intronic
927371408 2:22359355-22359377 AGATCTGAACAGATGGGGAATGG + Intergenic
929419023 2:41772093-41772115 AAATCTTAGCAGATGGGGTAGGG + Intergenic
930205425 2:48582915-48582937 AGATCTTTAGAGATTAATTAGGG - Intronic
931782804 2:65593603-65593625 ATAACTATATAGATGGGTTAAGG - Intergenic
931958495 2:67455158-67455180 AGAACTTTACTGATGACTTATGG - Intergenic
931960636 2:67478585-67478607 ATATCTTTACAGGTGGTTAATGG + Intergenic
933697219 2:85228652-85228674 AGATGTTGAGAGATGGGCTAGGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937755509 2:125533187-125533209 AGATATTTACAGTTAGGTTAAGG + Intergenic
942171870 2:173297472-173297494 AGATCTCTATATATGAGTTAGGG + Intergenic
945060537 2:205904890-205904912 AGCTATTTACACATGGGTCAAGG - Intergenic
1173430312 20:42982025-42982047 ATATCTTTTCAGATGAGTTTAGG - Intronic
1175939612 20:62531990-62532012 AGATCTTTCCAAAGGGGCTAGGG + Intergenic
1176704468 21:10101740-10101762 AGAACTTGACAGATGAATTAGGG - Intergenic
952705071 3:36369010-36369032 AGATCGTAAGAGCTGGGTTAGGG + Intergenic
956264197 3:67379234-67379256 AGAAATTTACACATGGGGTACGG - Intronic
956533921 3:70253807-70253829 ACATCTTTCTAAATGGGTTATGG - Intergenic
956592490 3:70929591-70929613 ATATATTTTGAGATGGGTTAGGG + Intergenic
965292009 3:166894357-166894379 ATATCTTTACAGATAGGGTTAGG + Intergenic
965328030 3:167332041-167332063 AAATATTTACATCTGGGTTAGGG - Intronic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
970839517 4:20450547-20450569 AGATCTTTAAAAATAGGATATGG - Intronic
971225550 4:24748378-24748400 AAATGTTTGCAGATGGGATAGGG - Intergenic
973964292 4:56145463-56145485 AGATATTAACAGATGGTCTATGG - Intergenic
974730625 4:65860464-65860486 AGATCATGACAGTTGTGTTAAGG + Intergenic
975279645 4:72546270-72546292 AGATCTTTACTGGTAGGGTAGGG - Intronic
976772145 4:88664905-88664927 AGATATTTGCAGAAGGGATAAGG - Intronic
980475118 4:133304404-133304426 TGATCTTTATAGATTGTTTATGG - Intergenic
981288943 4:143051661-143051683 AGATCTTTAAAGATTAGTCAGGG + Intergenic
983347877 4:166549957-166549979 AGATGTTAACAAATGGCTTAAGG + Intergenic
983915674 4:173288360-173288382 TGATATTTACAGATGGGTCATGG + Intronic
984051403 4:174869474-174869496 AGATCTCTACAGTTGTGTTTTGG - Intronic
985378545 4:189367888-189367910 GGATCTTTACAGCTGGTTTGTGG - Intergenic
988312056 5:29572177-29572199 AGATCATGACAGATTGGCTATGG + Intergenic
989108949 5:37888905-37888927 GGAGCTTTGCAGATGGATTAAGG + Intergenic
989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG + Intergenic
994278828 5:97875372-97875394 ACATTTTTACATTTGGGTTAAGG + Intergenic
995833704 5:116379938-116379960 AGATCCTTACAGGTGGCTTCAGG - Intronic
997247470 5:132362620-132362642 AGTTCTCTACAGATGGATGATGG + Intergenic
998736642 5:145149511-145149533 AGAGTTTTCCATATGGGTTATGG - Intergenic
1001723716 5:173878216-173878238 AGGTCTTTTCTGATGGCTTATGG - Intergenic
1002881379 6:1255391-1255413 AGATCAGTAAAGATGGTTTAGGG + Intergenic
1011390760 6:86850255-86850277 AGACCTTCACAGATTGGTTATGG - Intergenic
1013535354 6:111058641-111058663 ATTTCTTTACAGATGGGGTCTGG - Intergenic
1018940208 6:168304564-168304586 CGATGTTTGCAGATGGGTCAGGG + Intronic
1021736758 7:23647125-23647147 ATATCTTTTCAGATGAGTTTTGG + Intergenic
1023449987 7:40273573-40273595 ACATCTTTACATATGGGCCAAGG + Intronic
1031161067 7:118169246-118169268 AAAACTTTACAGATGTGCTAAGG + Intergenic
1034372126 7:150607987-150608009 AGATCATTACATAAGGGTAAAGG + Intergenic
1038070370 8:24006524-24006546 AGATCTTTACACAGGTGTTATGG + Intergenic
1039121019 8:34146464-34146486 AGCCCTTTACAGGTGGGGTAGGG - Intergenic
1039659359 8:39446499-39446521 AGAGCATTACACATGGATTAGGG - Intergenic
1039669560 8:39581068-39581090 AGAGCATTACACATGGGTTAGGG + Intergenic
1040733806 8:50482083-50482105 ACATCTTGACAGATTGATTAGGG - Intronic
1042807115 8:72783109-72783131 AGAACTTTACAGATACCTTATGG + Intronic
1044150235 8:88767452-88767474 AGATTTTTCCACAGGGGTTATGG + Intergenic
1044263032 8:90149758-90149780 ACAGCTTTAGAGTTGGGTTAAGG + Intergenic
1048714035 8:137246997-137247019 AAAACTTTACAGATGTGGTAAGG + Intergenic
1051159869 9:14195257-14195279 AGAGCTTTGCAGATGGATGAAGG - Intronic
1051326778 9:15980592-15980614 AGATCTGTACAGATGGTTTGGGG - Intronic
1052791963 9:32883652-32883674 AGATCTTTTCAGAACGGTTATGG + Intergenic
1053619892 9:39804144-39804166 AGAGTTTTGCAGATGGGTTGTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053878068 9:42563459-42563481 AGAGTTTTGCAGATGGGTTGTGG - Intergenic
1054233626 9:62538235-62538257 AGAGTTTTGCAGATGGGTTGTGG + Intergenic
1054264265 9:62903300-62903322 AGAGTTTTGCAGATGGGTTGTGG + Intergenic
1054322615 9:63686136-63686158 AGAACTTGACAGATGAATTAGGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1057326246 9:94066991-94067013 AGATTGTTAAAGCTGGGTTATGG - Intronic
1057485820 9:95483323-95483345 ATATCTTTCCAGGTGTGTTAGGG + Intronic
1058301058 9:103373602-103373624 AGGTCTGTTCAGATGGGTTGGGG - Intergenic
1060033800 9:120237662-120237684 ATATCATTGCTGATGGGTTAAGG - Intergenic
1202789503 9_KI270719v1_random:71832-71854 AGAACTTGACAGATGAATTAGGG - Intergenic
1185510105 X:657686-657708 GCATCTTTTCAGACGGGTTACGG - Intronic
1186422421 X:9436840-9436862 AGAACCTTCCAGAGGGGTTATGG - Intergenic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1188640554 X:32497100-32497122 AGATTTTGTCAGATGGGTGAGGG - Intronic
1189928877 X:45986656-45986678 AGATCTGTACATATGGATCAAGG - Intergenic
1192262787 X:69517398-69517420 AGATCTTTACAGATGAGGACAGG - Intronic
1192307678 X:69980224-69980246 AGGTCTTTACAGGAGGGTGAGGG - Intronic
1193928566 X:87522650-87522672 AGTTATTTACAGAAAGGTTAAGG + Intronic
1196929704 X:120669272-120669294 AGATCTTGACACATGGGATAGGG + Intergenic
1197254815 X:124251552-124251574 AGATTTGTATAGATGGGCTATGG + Intronic
1198726125 X:139678848-139678870 ACATCATTACAGATGTGTTTTGG + Intronic