ID: 1124831375

View in Genome Browser
Species Human (GRCh38)
Location 15:33153139-33153161
Sequence TGCTCTGAGGAAGGCCGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 291}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124831357_1124831375 30 Left 1124831357 15:33153086-33153108 CCTGGCCCCAAGCTCTTTTCCAA 0: 1
1: 0
2: 1
3: 48
4: 586
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831359_1124831375 24 Left 1124831359 15:33153092-33153114 CCCAAGCTCTTTTCCAAAGTTTC 0: 1
1: 0
2: 2
3: 30
4: 328
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831368_1124831375 -7 Left 1124831368 15:33153123-33153145 CCAACCGAGGTTGGCCTGCTCTG 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831364_1124831375 2 Left 1124831364 15:33153114-33153136 CCCCAGGCACCAACCGAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831367_1124831375 0 Left 1124831367 15:33153116-33153138 CCAGGCACCAACCGAGGTTGGCC 0: 1
1: 0
2: 1
3: 2
4: 42
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831362_1124831375 11 Left 1124831362 15:33153105-33153127 CCAAAGTTTCCCCAGGCACCAAC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831366_1124831375 1 Left 1124831366 15:33153115-33153137 CCCAGGCACCAACCGAGGTTGGC 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831360_1124831375 23 Left 1124831360 15:33153093-33153115 CCAAGCTCTTTTCCAAAGTTTCC 0: 1
1: 1
2: 5
3: 43
4: 442
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1124831358_1124831375 25 Left 1124831358 15:33153091-33153113 CCCCAAGCTCTTTTCCAAAGTTT 0: 1
1: 0
2: 2
3: 28
4: 347
Right 1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124831375 Original CRISPR TGCTCTGAGGAAGGCCGGGC TGG Exonic