ID: 1124833910

View in Genome Browser
Species Human (GRCh38)
Location 15:33177019-33177041
Sequence ACGTACTGGCCACTCTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124833907_1124833910 23 Left 1124833907 15:33176973-33176995 CCTTTAAATAATTAAGATAATTA 0: 1
1: 0
2: 7
3: 113
4: 1027
Right 1124833910 15:33177019-33177041 ACGTACTGGCCACTCTTCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124833910 Original CRISPR ACGTACTGGCCACTCTTCCA AGG Intronic
1074680747 10:115904440-115904462 TCCTACTGGCCATTCTCCCAGGG + Intronic
1086303953 11:85459902-85459924 ACACTCTGGCCACTTTTCCATGG + Intronic
1087457923 11:98410673-98410695 TCATACTGGTCACCCTTCCAGGG + Intergenic
1092884535 12:12913622-12913644 ATGTGGTGGCCACTCTTTCATGG + Exonic
1100156502 12:91805367-91805389 ACAATCTGGCCGCTCTTCCATGG - Intergenic
1103884946 12:124193371-124193393 ACGTGTTGGCAACTCTGCCAAGG + Intronic
1104200195 12:126581402-126581424 ACGGACTGTCAACTTTTCCATGG + Intergenic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1107695365 13:42994361-42994383 ACATACTGGCCACACAACCAAGG + Intergenic
1114362557 14:21991263-21991285 AGGTACTGTCCAGGCTTCCATGG + Intergenic
1122613202 14:102999772-102999794 AGTTACAGGCCAGTCTTCCATGG + Intronic
1122663222 14:103311721-103311743 ACACTCAGGCCACTCTTCCATGG + Intergenic
1124833910 15:33177019-33177041 ACGTACTGGCCACTCTTCCAAGG + Intronic
1125406428 15:39356788-39356810 AGGAACTGGCCACTCTGTCACGG + Intergenic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128366656 15:67008316-67008338 AGGTACTGGCCACTCTCCAAGGG + Intergenic
1130769699 15:86912226-86912248 TCGCACTGGGAACTCTTCCATGG - Intronic
1132261314 15:100427421-100427443 ACGTAATGGCCACTCATCTATGG - Intronic
1146618334 17:34374777-34374799 CCGTACTGGGCACTGTTCTATGG + Intergenic
1146794407 17:35771100-35771122 ACGTGCTAGGCACTGTTCCAAGG - Intronic
1149430248 17:56591983-56592005 AAGTATTTGCCAGTCTTCCATGG - Intergenic
1159620602 18:70633843-70633865 TTGCACTGGCCACACTTCCAAGG - Intronic
1159878737 18:73837827-73837849 ACATACTGGTCACTCTTTAATGG - Intergenic
1160301779 18:77688122-77688144 ACTTCCTGGCCAATCGTCCATGG + Intergenic
1162004185 19:7766679-7766701 AAGGACTGGACATTCTTCCAAGG + Exonic
1165915286 19:39254849-39254871 ACACACTGGCCATTCTACCATGG - Intergenic
925646746 2:6044224-6044246 ACGGTCTGGCCACTTTTCCTCGG - Intergenic
931146117 2:59520776-59520798 ACATACATGCCATTCTTCCATGG + Intergenic
949000146 2:241608642-241608664 ACGTGCTGGACACTCTTCCAGGG + Intronic
1174000127 20:47368552-47368574 AAGTGCAAGCCACTCTTCCAAGG - Intergenic
1175773194 20:61636598-61636620 AGGCTCTGGCCTCTCTTCCACGG + Intronic
1182079362 22:27518318-27518340 ACCTACTGGACACTCTGCAAGGG - Intergenic
1184459969 22:44631702-44631724 TTGTAGTGGCAACTCTTCCATGG - Intergenic
951390508 3:22097632-22097654 ACATACTGGCCTTTCTTCCCTGG - Intronic
958838291 3:99172014-99172036 ACAGTCTGGCCACTTTTCCACGG - Intergenic
972841343 4:42933340-42933362 AAGAAGTGGTCACTCTTCCAAGG + Intronic
972969747 4:44558884-44558906 CTGTACAGGTCACTCTTCCAGGG - Intergenic
974551958 4:63387450-63387472 ATGTACTAGCCATCCTTCCATGG - Intergenic
978796742 4:112715352-112715374 ACGTACATCCCACTATTCCATGG + Intergenic
985961608 5:3306994-3307016 AGCTACTGCCCACTCCTCCACGG + Intergenic
990281990 5:54261014-54261036 ACCTACTGGCCTGTCTTCTAGGG - Intronic
992468365 5:77029698-77029720 AAGTTCTGGCCAATCTACCAGGG + Intronic
1001234073 5:170014729-170014751 GCCTACTGCCCACTCCTCCAGGG - Intronic
1001751150 5:174132416-174132438 CCATACAGGCCACTCTTCCCGGG + Intronic
1002437594 5:179241314-179241336 AGGTACTGGCCACTGGTGCAGGG - Intronic
1002448697 5:179307041-179307063 ACGTGCTGGCCTCACCTCCAAGG - Intronic
1009737665 6:67698614-67698636 ACCTACTGGCCAGATTTCCAAGG - Intergenic
1015804230 6:137092312-137092334 AGGTACTGGCCACCCTCCCAAGG + Intergenic
1028177178 7:87672478-87672500 ACCTACAGGCCCCACTTCCACGG - Intronic
1029629642 7:101742476-101742498 ACGTACTGACCACTCTGAGAAGG + Intergenic
1034070800 7:148182855-148182877 ACTTTCTAGCTACTCTTCCAAGG + Intronic
1037435308 8:18856378-18856400 ATGTGCTGGCCACTATGCCAGGG + Intronic
1038351219 8:26777876-26777898 AAGTGCTGCCCACTTTTCCAGGG + Intronic
1048235310 8:132683855-132683877 TCACACTGGCCATTCTTCCAGGG - Intergenic
1050443663 9:5694646-5694668 CCTTATTGGCCACACTTCCAAGG + Intronic
1052164746 9:25311309-25311331 ACATACTTGGCACTCTTTCAGGG - Intergenic
1060943299 9:127555767-127555789 AAGAAATGGCCACTCTTCCCTGG - Intronic
1186620842 X:11238544-11238566 ACTTACTGGCCAGCCCTCCATGG + Intronic
1193858827 X:86639606-86639628 ACCCACTGGCCCCACTTCCAAGG + Intronic
1194195248 X:90883888-90883910 ACAGACTGGCCACTTTTCCATGG + Intergenic
1197365620 X:125562052-125562074 ATATTCTGGCCACTTTTCCATGG - Intergenic
1200798793 Y:7366631-7366653 ACGTACTGGCTTCTGTTTCATGG + Intergenic
1200888397 Y:8296233-8296255 AAGTATTGGTCCCTCTTCCAAGG - Intergenic