ID: 1124843300

View in Genome Browser
Species Human (GRCh38)
Location 15:33264742-33264764
Sequence CAATCAGGGCATGAGCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124843300_1124843305 16 Left 1124843300 15:33264742-33264764 CCATGTGGCTCATGCCCTGATTG No data
Right 1124843305 15:33264781-33264803 AATGTCATTTTAGTCCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124843300 Original CRISPR CAATCAGGGCATGAGCCACA TGG (reversed) Intergenic
No off target data available for this crispr