ID: 1124844697 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:33279114-33279136 |
| Sequence | GCTGACGGGACAGGTGAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1124844687_1124844697 | 10 | Left | 1124844687 | 15:33279081-33279103 | CCAACATGGCATCAGAGTCATGG | No data | ||
| Right | 1124844697 | 15:33279114-33279136 | GCTGACGGGACAGGTGAGGCTGG | No data | ||||
| 1124844686_1124844697 | 16 | Left | 1124844686 | 15:33279075-33279097 | CCATGTCCAACATGGCATCAGAG | No data | ||
| Right | 1124844697 | 15:33279114-33279136 | GCTGACGGGACAGGTGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1124844697 | Original CRISPR | GCTGACGGGACAGGTGAGGC TGG | Intergenic | ||