ID: 1124844697

View in Genome Browser
Species Human (GRCh38)
Location 15:33279114-33279136
Sequence GCTGACGGGACAGGTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124844687_1124844697 10 Left 1124844687 15:33279081-33279103 CCAACATGGCATCAGAGTCATGG No data
Right 1124844697 15:33279114-33279136 GCTGACGGGACAGGTGAGGCTGG No data
1124844686_1124844697 16 Left 1124844686 15:33279075-33279097 CCATGTCCAACATGGCATCAGAG No data
Right 1124844697 15:33279114-33279136 GCTGACGGGACAGGTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124844697 Original CRISPR GCTGACGGGACAGGTGAGGC TGG Intergenic