ID: 1124848101

View in Genome Browser
Species Human (GRCh38)
Location 15:33311094-33311116
Sequence ACTGTGAGTCTCCGCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124848096_1124848101 -10 Left 1124848096 15:33311081-33311103 CCAGTTTCTGAGGACTGTGAGTC 0: 1
1: 0
2: 0
3: 9
4: 192
Right 1124848101 15:33311094-33311116 ACTGTGAGTCTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1124848093_1124848101 21 Left 1124848093 15:33311050-33311072 CCGAAGGGGGAGAAGGAGGCGAG 0: 1
1: 0
2: 2
3: 29
4: 244
Right 1124848101 15:33311094-33311116 ACTGTGAGTCTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1124848091_1124848101 27 Left 1124848091 15:33311044-33311066 CCATGGCCGAAGGGGGAGAAGGA 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1124848101 15:33311094-33311116 ACTGTGAGTCTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124848101 Original CRISPR ACTGTGAGTCTCCGCGGCGG GGG Exonic