ID: 1124851343

View in Genome Browser
Species Human (GRCh38)
Location 15:33341602-33341624
Sequence TCTACCATCTAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124851339_1124851343 3 Left 1124851339 15:33341576-33341598 CCAAAAATGGAGTATATATTGTA 0: 1
1: 0
2: 2
3: 32
4: 282
Right 1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124851343 Original CRISPR TCTACCATCTAGAAGCAGGA GGG Intronic
904915134 1:33964729-33964751 TCAACCATCTAGGGCCAGGAAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
912173676 1:107132141-107132163 TCTATCATCCAGAAACATGAAGG + Intergenic
916306422 1:163339639-163339661 TCAACCATCTAGAACCGTGATGG + Intronic
919520927 1:198585448-198585470 TCTACCATCTAAAGGCATTATGG + Intergenic
919934263 1:202241339-202241361 TCTACCAGCTAGAACCAGATGGG + Intronic
920081847 1:203380368-203380390 TCTACCACGTAGATGCAGTAGGG + Intergenic
920692996 1:208160895-208160917 TCTACCTTGTAGAGACAGGAAGG + Intronic
921261214 1:213386583-213386605 TCTTCCATCTACATCCAGGAGGG + Intergenic
922380672 1:225020961-225020983 TTTACCATGGAGAAGTAGGAAGG + Intronic
1067758051 10:49020672-49020694 TGTACCATCAAAAAGAAGGAAGG + Intronic
1069460959 10:68594283-68594305 TGTACCAACTAGAAACTGGAAGG - Intronic
1073978162 10:109123769-109123791 TATATTAGCTAGAAGCAGGAAGG - Intergenic
1076632106 10:131857522-131857544 GCTTCCTTCTAGAAGCTGGAAGG - Intergenic
1076640710 10:131914938-131914960 TCTAGCAACTCGAAGGAGGAAGG + Intronic
1077806690 11:5597214-5597236 TCTTCCATCTATAAGATGGACGG + Intronic
1081025656 11:38010781-38010803 TCTACCAGCTATACGCAGCAAGG + Intergenic
1081740331 11:45435117-45435139 TCTACCTTCCAGTAGCAGGTAGG + Intergenic
1081767146 11:45619472-45619494 TCTAGGATCTATAACCAGGAAGG - Intergenic
1085092304 11:73727554-73727576 TCTACCATTTAGTAGTTGGATGG - Intronic
1085483738 11:76843983-76844005 TCTACCATGTAGAAAAAGGGCGG - Intergenic
1087781468 11:102305296-102305318 ACTACCAACCAGAAGCAGGGAGG - Intergenic
1091668697 12:2437463-2437485 TCTACCACCTACTAGCAGTAAGG + Intronic
1092083886 12:5739935-5739957 TCTATCAGCTACATGCAGGATGG - Intronic
1092535960 12:9387575-9387597 TCAACAAACTAGAAACAGGAAGG - Intergenic
1093980954 12:25474988-25475010 GTTACAAGCTAGAAGCAGGAGGG + Intronic
1098135947 12:67401922-67401944 TCTATCAACAAGAAGCTGGAAGG - Intergenic
1099691070 12:85952454-85952476 TATGCCATCTACAAGCTGGAGGG + Intergenic
1102989325 12:117303509-117303531 TTTACCAGCTAGAGGCTGGAGGG + Intronic
1103617271 12:122162305-122162327 TCTCCCATCTAGAGACAGCATGG + Intergenic
1104743135 12:131193476-131193498 TCTGCCTTCCTGAAGCAGGATGG - Intergenic
1106619750 13:31361933-31361955 TCATCCATCCAGGAGCAGGAAGG - Intergenic
1107691845 13:42961235-42961257 TCTAGCAGGTAGGAGCAGGAGGG + Intronic
1107904326 13:45048151-45048173 ATTACCATCTAGAAGCTGGTGGG + Intergenic
1109463955 13:62702681-62702703 TATACCATCTGCCAGCAGGATGG + Intergenic
1109930764 13:69214629-69214651 TCATCCATCTAGGAGCAGTATGG + Intergenic
1110477410 13:75932694-75932716 TCTACCACATAAAACCAGGAAGG - Intergenic
1110612418 13:77503699-77503721 TTTACCAGCTTGAAGCAGGTAGG - Intergenic
1111623799 13:90757351-90757373 TCTACAATCTGCAAGCTGGAGGG - Intergenic
1118891823 14:69916407-69916429 TCTACCCTCTGTAAGCAGCATGG + Intronic
1119318716 14:73716918-73716940 TATACCCTGTAGAAGCAGGGGGG - Exonic
1119749023 14:77064583-77064605 TCTTCCTTCTAGAACAAGGAAGG + Intergenic
1120304440 14:82750501-82750523 TCTCCCATCTTGAAGGAGGTGGG - Intergenic
1120939216 14:89930628-89930650 GCAACCATCTTGAAGCAAGAGGG + Intronic
1121588506 14:95081039-95081061 GCTACCATGTAAAAGCAGTAAGG + Intergenic
1122172042 14:99884783-99884805 TCTAGCACCTAGGAGGAGGAGGG + Intronic
1122406096 14:101502006-101502028 GCTGCCATCTAGAAGCACCAGGG + Intergenic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1127048531 15:55054300-55054322 TCTACCATTAACAAGCAAGATGG - Intergenic
1127381456 15:58434109-58434131 TCTACCCACTAGATGCTGGAAGG - Intronic
1129233677 15:74210859-74210881 TCACCCAGCTAGAAGGAGGAGGG - Intronic
1129642988 15:77401142-77401164 TCTACCCACTAGAAGTAGGCTGG + Intronic
1130337551 15:82970088-82970110 GCTACCACCTATAAGCTGGATGG - Intronic
1131496153 15:92912875-92912897 TCTTCCATTTAGATGCAGGTTGG + Intronic
1133937279 16:10279444-10279466 TCACCCAGCTAGAAGTAGGAGGG + Intergenic
1140239608 16:73189234-73189256 TCTACCTTCTAGAAGCTGCTGGG + Intergenic
1140529641 16:75653587-75653609 TATACCATCTACAAAAAGGAGGG - Intronic
1140909707 16:79440132-79440154 ACTACCACCTGGATGCAGGAAGG + Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1150132321 17:62675808-62675830 TCTCCCAGCCAGTAGCAGGATGG - Exonic
1150222628 17:63505797-63505819 TCTACATGCTTGAAGCAGGAAGG + Intronic
1155512936 18:26595517-26595539 TCTGCCAGCAAGAAGGAGGAAGG - Intronic
1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG + Intronic
1156857213 18:41795744-41795766 TCTACCATTTAGAAATATGAAGG + Intergenic
1157887865 18:51385660-51385682 TCTACTATTTAGAAGCAGGTGGG + Intergenic
1159470605 18:68850533-68850555 TCAACCACCTAGAAGGAAGAGGG - Intronic
1167293953 19:48638774-48638796 TAGACCATATAGACGCAGGAAGG + Intronic
1168485854 19:56761238-56761260 TCTGCCATCTGGATGCGGGAGGG + Intergenic
925402030 2:3581668-3581690 TTCACCCTATAGAAGCAGGAAGG - Intergenic
926029462 2:9573353-9573375 TCAACCATGTAGAAACTGGAGGG + Intergenic
929063057 2:37942973-37942995 TCTAGCATCTGGCTGCAGGATGG - Intronic
931078490 2:58742860-58742882 TCTTCCATCTAAAAACAAGACGG - Intergenic
933198853 2:79424710-79424732 TCTAACTACTACAAGCAGGAGGG + Intronic
936744399 2:115557333-115557355 CCTACCATATAGAAGCAAGAAGG + Intronic
937790768 2:125958670-125958692 TCTACCATGTAGAAGGTTGATGG + Intergenic
939840379 2:147180988-147181010 GTTACCATCGAGAAACAGGAGGG + Intergenic
939873092 2:147546976-147546998 ACTGACATTTAGAAGCAGGAAGG + Intergenic
939913496 2:148011549-148011571 TCTAGGATCTAGAAGAAGGATGG + Intronic
940024942 2:149196379-149196401 TCTATCATTTTGAAACAGGAGGG - Intronic
1170701140 20:18704682-18704704 TCTACCCACTAGAAGCTGGTAGG - Intronic
1170850640 20:20000989-20001011 TCAAGCATGTAGAAGCGGGAAGG - Exonic
1174803442 20:53584964-53584986 TTTAGCATCTAAAAGTAGGAAGG - Intronic
1177162158 21:17559483-17559505 TCTACAATATACAAGCAGGCTGG - Intronic
1179311322 21:40198558-40198580 ACTGCCACCTAGAAGCAGGGAGG + Intronic
1180561233 22:16615695-16615717 TTTAGCATCTAAAAGTAGGAAGG + Intergenic
1180604745 22:17049039-17049061 TCAACAAACTAGAAACAGGAGGG + Intergenic
1181578908 22:23816034-23816056 TCCATCATCAAGAAGCAGGTCGG - Intronic
1182037035 22:27207006-27207028 TCAACCATCTACTAGCTGGAAGG + Intergenic
1182145198 22:27993170-27993192 TCTCCCAGCTAGGAGCAGGAGGG - Intronic
1184205926 22:43002980-43003002 TCTCCCATCTACAAACTGGATGG + Intronic
1184633979 22:45811570-45811592 TCTATAGTCTAGAAGCAGTAGGG + Intronic
1185388137 22:50545889-50545911 TCTACCAGGCAGAAGCAGGTTGG + Intergenic
952204822 3:31170816-31170838 TCTCTCACTTAGAAGCAGGAGGG - Intergenic
955004015 3:54952707-54952729 TTTCCCATCTGGAAGCTGGAGGG - Intronic
955763752 3:62318529-62318551 TCTACCAACTATGAGCAGGCAGG + Intergenic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962463203 3:135633524-135633546 TATACCTTCAAGTAGCAGGAGGG + Intergenic
966994759 3:185268675-185268697 TAAACCAGCTAGAAGCAAGATGG + Intronic
968348996 3:198036643-198036665 TAAACCCTTTAGAAGCAGGAGGG + Intronic
968667825 4:1830834-1830856 TCTAGAGTCAAGAAGCAGGAAGG - Intronic
971120492 4:23699081-23699103 TAGATCATCTAGAGGCAGGATGG + Intergenic
972069790 4:35003708-35003730 TCAACAAACTAGAAGCAGAAAGG - Intergenic
974819859 4:67052443-67052465 TATACAATCTTGAAGAAGGAAGG - Intergenic
976471470 4:85434150-85434172 GCTGGCATCTAGAAGCTGGAAGG - Intergenic
976529201 4:86131984-86132006 TCTACTGACTAGAAGCAGAAAGG - Intronic
980560587 4:134468464-134468486 TCTACCATTTATAAGTAAGAGGG + Intergenic
980854814 4:138426537-138426559 TCTACCACCAAGGGGCAGGATGG + Intergenic
983313567 4:166097413-166097435 TCTACCATTTGGAAGATGGAGGG + Intronic
985334746 4:188879766-188879788 TATATCATCTAGAAACAAGAAGG + Intergenic
989392487 5:40915785-40915807 TCTAACAGCCAGAAGCAGGCAGG + Intronic
990536399 5:56727494-56727516 TCTATCATCAAGAAGCAAGAAGG - Intergenic
990818044 5:59807376-59807398 TCTGCCCTCTAGAAGAAGCATGG - Intronic
995338326 5:111027977-111027999 TTTAACATCAAGAGGCAGGAAGG + Intergenic
1000462837 5:161544649-161544671 CCTACCTTTTAGAAACAGGATGG + Intronic
1002059667 5:176619120-176619142 TCTTCCAGCTAGAGGCTGGAGGG + Intergenic
1006373012 6:33656977-33656999 TCTACCTGCTGGCAGCAGGAAGG - Intronic
1006418869 6:33921093-33921115 TGTGCCAGGTAGAAGCAGGAAGG + Intergenic
1006442758 6:34062279-34062301 TATAGCAGCTAGAAGCAGCACGG + Intronic
1006604112 6:35244029-35244051 CCTACCAACCTGAAGCAGGACGG + Exonic
1010327162 6:74577768-74577790 TCTACCCATTAGAAACAGGAAGG + Intergenic
1010982288 6:82381907-82381929 TATACTATCCAGAAGGAGGATGG - Intergenic
1013607972 6:111768063-111768085 TCTACCTTCAAAAAGCAGGGGGG + Intronic
1015635648 6:135271413-135271435 TCTACCAGCTGGAAGCCAGAAGG + Intergenic
1017134181 6:151133816-151133838 TCTCCCCTTTAGGAGCAGGAAGG + Intergenic
1020104000 7:5412748-5412770 TGCTCCATCTAGAGGCAGGATGG - Intronic
1021928128 7:25552884-25552906 GCTACCTTCTAGCAGCCGGAGGG - Intergenic
1023475648 7:40575081-40575103 TCAACAAGATAGAAGCAGGATGG + Intronic
1024712740 7:52035389-52035411 TCTGCCATCTGCAGGCAGGAGGG - Intergenic
1024724275 7:52175091-52175113 TATGACAGCTAGAAGCAGGAAGG + Intergenic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1030535786 7:110765167-110765189 TCTACTATGTAAAAGCAGGTAGG + Intronic
1030879816 7:114863973-114863995 TCTTCCATCTAGAAGTGGGCTGG - Intergenic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1037635080 8:20694355-20694377 TCTGAAATCTACAAGCAGGAAGG - Intergenic
1038069977 8:24003100-24003122 TCCACCATCTAGAAGCAAAATGG - Intergenic
1038512437 8:28151836-28151858 TCTCCCAGCCAGAAGCAGAAGGG + Intronic
1039591806 8:38756349-38756371 TGTAACATCAAGATGCAGGATGG + Intronic
1040610092 8:48975647-48975669 TGTACCATCTTGAATTAGGAAGG - Intergenic
1043481389 8:80656233-80656255 GCAGCCATCTACAAGCAGGAAGG + Intronic
1044325741 8:90855569-90855591 CCTTCCATCTATAATCAGGAAGG + Intronic
1045533411 8:103005075-103005097 TATATCATCCAGAAGCAGGGAGG - Intergenic
1045992409 8:108324508-108324530 TGTCCCATTTAGAAACAGGAAGG + Intronic
1047298742 8:123594424-123594446 TCTACCAAGAAGAAGCAGGATGG - Intergenic
1049497247 8:142941982-142942004 TCTGCCATCTAGAAGAAGGTGGG - Intergenic
1050002037 9:1087369-1087391 TCTAACATATAGACCCAGGAGGG + Intergenic
1051295389 9:15589398-15589420 TCTACAATCTAGAAACAGAAGGG - Intronic
1052011781 9:23419298-23419320 CCTTTCATCTAGAAGCAGGCTGG + Intergenic
1052396360 9:27943491-27943513 TCTCCCTTCCAGAAGCAGGTGGG - Intergenic
1054827722 9:69589916-69589938 TCCTCCATAGAGAAGCAGGAGGG - Intronic
1055257403 9:74387580-74387602 GGTACCATCTAAAGGCAGGATGG - Intergenic
1056410689 9:86323506-86323528 TATACCATCCAGAAACAGGAAGG - Exonic
1058849623 9:108998216-108998238 TCTACCTACTAGATGCTGGAAGG - Intronic
1059261943 9:112985532-112985554 TCTGCCATTTAGAAGCTGGGTGG + Intergenic
1059456060 9:114401037-114401059 CCTCCCACCTAGCAGCAGGAGGG - Intergenic
1060304269 9:122396812-122396834 TCTAGCCTGTATAAGCAGGAAGG + Intergenic
1060524767 9:124314233-124314255 ACTGCCATGTACAAGCAGGAGGG - Intronic
1186871262 X:13776176-13776198 TCTGTCATTTAGAAGCTGGAGGG + Intronic
1195022144 X:100839825-100839847 TCTACTATCCAGAAACAGTAAGG - Intronic
1196858856 X:120008657-120008679 TCCACCTGCTGGAAGCAGGAAGG - Intergenic
1197341864 X:125284973-125284995 TCTACCTGCTGGATGCAGGAAGG + Intergenic
1197765587 X:130057522-130057544 TGTACCATCCAAAGGCAGGAGGG + Exonic
1199065081 X:143406520-143406542 ACTACCAAGTAGAACCAGGATGG - Intergenic
1200081377 X:153578463-153578485 CCTGGCTTCTAGAAGCAGGAGGG + Intronic