ID: 1124854104

View in Genome Browser
Species Human (GRCh38)
Location 15:33370389-33370411
Sequence CTGTGCCAGTAAAAGTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124854104_1124854106 28 Left 1124854104 15:33370389-33370411 CCTTGATACTTTTACTGGCACAG 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1124854106 15:33370440-33370462 GATGTGCTAAGAAGAGCAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124854104 Original CRISPR CTGTGCCAGTAAAAGTATCA AGG (reversed) Intronic
903809293 1:26025925-26025947 ATGAGCCTATAAAAGTATCATGG - Intronic
904916664 1:33975376-33975398 CAGTGCCTGGAACAGTATCAGGG + Intronic
906066399 1:42984253-42984275 CTGAGCAAGGAAAATTATCAGGG - Intergenic
907177226 1:52536220-52536242 CTGTGACAATAAAAATATAAAGG + Intronic
910992216 1:93067998-93068020 CTGTGCCAGAAACAGTTGCAAGG + Intergenic
911682764 1:100736698-100736720 CTGAGCTAGTCAAAGTATAAAGG - Intronic
913547386 1:119882666-119882688 CTGTGGCAGTAAATATAACAGGG - Intergenic
913556819 1:119975679-119975701 CTGTGGCAGTAAATATAACAGGG + Intronic
914984176 1:152442089-152442111 CTGTGCCAGTAAATGTGTGGGGG + Intergenic
916606806 1:166351026-166351048 CTGTGTCAGTAAAAGCTTAAAGG - Intergenic
919546630 1:198929860-198929882 CTATGCCAATAAGAATATCAGGG - Intergenic
921752669 1:218815243-218815265 CTGAGCCAGTAGAAGGAACATGG + Intergenic
1067209294 10:44245353-44245375 CTGTACCCTTAAAAGTAACATGG - Intergenic
1067685093 10:48461945-48461967 CTGTGCCAGGCACTGTATCAGGG - Intronic
1070454487 10:76598685-76598707 CAGGGCCACTAAAATTATCAAGG - Intergenic
1071842137 10:89483405-89483427 CAGGGCCAGTAACAGCATCATGG + Intronic
1078713187 11:13815101-13815123 ATGGGCCCTTAAAAGTATCATGG + Intergenic
1079323763 11:19474085-19474107 CTGTGCCAGAAATAATTTCAGGG + Intronic
1079609686 11:22416510-22416532 CAGTGCCAGTAAATTGATCACGG + Intergenic
1080155912 11:29110683-29110705 CAGTGCCAGTAAAAGCAATAGGG - Intergenic
1087206714 11:95404220-95404242 CTGCTCCAGTAAAGGTAGCAGGG + Intergenic
1087208061 11:95417856-95417878 CTGTGCCAGCAAAAGGGCCAGGG - Intergenic
1088671784 11:112147873-112147895 CTGAGCCAGTAAGAGTAGCCAGG - Intronic
1093182114 12:15978605-15978627 CTGTGCTATTCAAAGTAGCATGG + Intronic
1098591851 12:72223376-72223398 CTTTACCAGTCACAGTATCAGGG - Intronic
1098955368 12:76684093-76684115 CTGGGCTAGTAAAAGAATAAGGG + Intergenic
1103138222 12:118526334-118526356 CAGTGCCAGAAAAATTTTCAGGG + Intergenic
1103658003 12:122489397-122489419 CTGTGCCATTAAAAACAACAAGG - Exonic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106108373 13:26755433-26755455 TAGTGCCAATAAAAATATCATGG - Exonic
1111681979 13:91453908-91453930 ATGATCCAGTAAAAGTATAATGG - Intronic
1114244800 14:20902768-20902790 CTGTATCAATAAAAGTCTCAGGG + Intergenic
1114247804 14:20930918-20930940 CTGTATCAATAAAAGTCTCAGGG + Intergenic
1117761816 14:59037183-59037205 CTTTGCCAGGAAAAGGGTCATGG + Intergenic
1118835285 14:69473581-69473603 CTGAGCCAGTAATAGGATCCGGG - Intergenic
1119619872 14:76124031-76124053 CTGTGCCAGTCAGAGTCACAGGG - Intergenic
1121998310 14:98624281-98624303 CTGTGCCAATTAAACCATCAAGG + Intergenic
1124562503 15:30788179-30788201 CTGTGGCAGTAAATATATCCTGG + Intergenic
1124854104 15:33370389-33370411 CTGTGCCAGTAAAAGTATCAAGG - Intronic
1126781396 15:52142082-52142104 TTTTGCCAATAAGAGTATCAAGG + Intronic
1129837267 15:78717894-78717916 CTGTGGCAGTAAATATATCCTGG + Intronic
1130268003 15:82426634-82426656 CTGTGGCAGTAAATATATCCTGG + Intergenic
1130476176 15:84269930-84269952 CTGTGGCAGTAAATATATCCTGG + Intergenic
1130483596 15:84383984-84384006 CTGTGGCAGTAAATATATCCTGG + Intergenic
1130504021 15:84520200-84520222 CTGTGGCAGTAAATATATCCTGG - Intergenic
1134621237 16:15691121-15691143 CTGTGCCAGAAAAAGGATTCAGG - Intronic
1135796098 16:25444375-25444397 CTGTGCCAGTAATAGTACTAAGG + Intergenic
1137320737 16:47379214-47379236 CAGTGTCAGTAAAAGCCTCAAGG - Intronic
1140931283 16:79630595-79630617 CTCTCCCAGGAAAAGTATGAAGG + Intergenic
1149109790 17:53014602-53014624 CTGCTCCAGTAAATGTGTCATGG - Intergenic
1151194395 17:72421320-72421342 CGCTGCCAGTAAGAGTGTCATGG - Intergenic
1156638966 18:39066832-39066854 CTGTGCCAGAAAAAGGTACAAGG + Intergenic
1157482244 18:48062883-48062905 CTGTGCCAGGACAAGCATCTTGG - Intronic
1159410603 18:68071031-68071053 CAGTGCAAGAAAAAGTAGCATGG + Intergenic
1163682313 19:18690187-18690209 CTGGGCCAGAAAAAGTACCCAGG + Intronic
1164183153 19:22837497-22837519 TGGTGCCAGAAAAAATATCATGG + Intergenic
1165595008 19:37005797-37005819 CTGTTCAAGGAAAAGTGTCAGGG + Intergenic
1166847936 19:45741471-45741493 ATGAGCCCCTAAAAGTATCATGG + Intronic
1168001387 19:53449029-53449051 CTGTGTCAATAAAAGTTTCTGGG + Intronic
1168005808 19:53486155-53486177 CTGTGTCAATAAAAGTTTCTGGG + Intronic
926956136 2:18302906-18302928 CTGTGCCAGGAACAATGTCATGG - Intronic
930206396 2:48590825-48590847 CTGTTCCAGTCAAAGTATTTTGG + Intronic
931675963 2:64696430-64696452 CAGTGCCAGTAACTCTATCACGG + Intronic
931919276 2:66995567-66995589 CTGTTCCAGCAAAAGTATATGGG - Intergenic
932374008 2:71218756-71218778 CTGTGGCAGTAAATATATCCTGG - Intronic
933574167 2:84048040-84048062 CTGAGCAAGGAAAATTATCAAGG + Intergenic
934126275 2:88894523-88894545 CAGAGCAAGGAAAAGTATCAAGG - Intergenic
934155394 2:89195000-89195022 CTGTGCCACTGCAAGTTTCATGG - Intergenic
934211929 2:89987754-89987776 CTGTGCCACTGCAAGTTTCATGG + Intergenic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
939294395 2:140240811-140240833 ATGTGCATGTGAAAGTATCAAGG + Intronic
939620138 2:144408914-144408936 TTGTTCCAGAAAAAGCATCAAGG + Intronic
940149745 2:150586397-150586419 CTGTGCCAATAAAAGAAAAAAGG - Intergenic
940867298 2:158830004-158830026 CGGTGCCATTAAATGAATCAGGG + Intronic
941431215 2:165416929-165416951 CTGTACCATTAAAAGTGGCAGGG + Intergenic
942296112 2:174518725-174518747 CTGTGCCGATAAAGGTAACAAGG - Intergenic
944384412 2:199148689-199148711 CTGTTGTAGTAAACGTATCATGG - Intergenic
945946502 2:216000529-216000551 CAATGCCAGGAAAAGTACCAGGG - Intronic
1170119565 20:12896752-12896774 CAGTGCCAGCAAACCTATCACGG + Intergenic
951162954 3:19448832-19448854 CTGTCCCAGAATAAGGATCAGGG + Intronic
951338739 3:21457911-21457933 CTGTGCCAGGAATTATATCAAGG + Intronic
957963178 3:87287082-87287104 CTTTTCTAGAAAAAGTATCAAGG - Intergenic
959846214 3:111036437-111036459 CAGTGCCAGTATAAATACCATGG + Intergenic
961331242 3:126140629-126140651 CTGTGACAGTAACACTATAAAGG + Intronic
962293179 3:134154441-134154463 CAGTGCCAGAAAATGTTTCATGG - Intronic
962649407 3:137473505-137473527 CTGTACCTGTAAAAGCCTCAGGG - Intergenic
964899055 3:161635458-161635480 CTCTGCAAGTGAAATTATCATGG - Intergenic
965856769 3:173098753-173098775 CTGTGCCATTAGAAGCACCATGG - Intronic
967763959 3:193257179-193257201 CTGTTACAGTTAAAGAATCACGG + Intronic
974751485 4:66146986-66147008 CTCTGCTAGATAAAGTATCAGGG + Intergenic
975078123 4:70238833-70238855 CTGAGCCACTAGTAGTATCATGG + Intergenic
976932048 4:90578748-90578770 TTCTGCCTGTAAAAGTATCTAGG + Intronic
978101639 4:104848565-104848587 CTGTACTTTTAAAAGTATCAAGG - Intergenic
978125670 4:105132385-105132407 CTCTGCCAGCAAAAAGATCATGG - Intergenic
979416264 4:120443193-120443215 CTGTGCCAACAAAATTTTCAAGG - Intergenic
982090461 4:151875957-151875979 CTGTGCCAGGAACAGTTTCCCGG - Intergenic
989775218 5:45198618-45198640 TTATGGAAGTAAAAGTATCATGG - Intergenic
992528363 5:77632489-77632511 CTCTGCAAGCTAAAGTATCAGGG + Intronic
995972798 5:117993067-117993089 CTGTGCCAGTATCAGAATAATGG + Intergenic
998698254 5:144666086-144666108 CTGAGCCACTAACAGTGTCAAGG - Intergenic
1001763330 5:174225302-174225324 CTGTACAAGTAAAAGAAGCACGG - Intronic
1002117349 5:176973375-176973397 CTGTGGTATTAAAAATATCATGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005464086 6:26094824-26094846 CTGTCCCAGAAAAAGCATCATGG + Exonic
1006572571 6:35017789-35017811 CTGTGTGAGTCAAAGTTTCAGGG - Exonic
1008247692 6:49198848-49198870 CTGTGCAAATAAATCTATCAGGG - Intergenic
1010165057 6:72905783-72905805 CTGTTCCAGTAGAGGTGTCAGGG + Intronic
1010422836 6:75693451-75693473 TTGGGCCAGCAAAAGTCTCATGG + Intronic
1010542169 6:77104824-77104846 CTGTTCCAGTAAAAAAAACATGG - Intergenic
1015001173 6:128217826-128217848 CTGAGACTGTAAAACTATCATGG - Intronic
1016375653 6:143418046-143418068 CTGAGCCAGTAAAAGGAAAAAGG - Intergenic
1017488784 6:154926066-154926088 CTTTGCCAGTAAGAGTAACTGGG - Intronic
1017999693 6:159568318-159568340 ATGTGCCACTAAGAGTAGCATGG + Intergenic
1018060327 6:160085008-160085030 CTGTGCCAGAAAATATATAAAGG + Exonic
1020937842 7:14489903-14489925 CTGTCCCAGTATAATTCTCAAGG - Intronic
1022002497 7:26239233-26239255 CTGTGACAGTAAGTGTTTCAGGG + Intergenic
1026623880 7:71975348-71975370 TTGTGCCAGGAAAATTAACAAGG - Intronic
1028912375 7:96223147-96223169 CTTTGCCTGGATAAGTATCAGGG - Intronic
1031597671 7:123666766-123666788 CTGTGGTAGTAACAGTCTCAGGG - Intergenic
1031726347 7:125244449-125244471 CTGTACCAGTAAAAATATGAAGG - Intergenic
1032098114 7:128949733-128949755 CTGTGCTATTAAATATATCAGGG + Intronic
1036734389 8:11297877-11297899 CTGTGCCAGGAAAAGGATAGAGG - Intronic
1038679786 8:29656131-29656153 CAGTGCCAGTTGATGTATCATGG + Intergenic
1039303820 8:36239295-36239317 CTCTGCCACTGAAAGTTTCATGG - Intergenic
1041385665 8:57299239-57299261 CTGTCCCAGTGGAAGAATCAGGG - Intergenic
1041848075 8:62354840-62354862 CTCTGCCTGTACATGTATCAGGG - Intronic
1048836984 8:138529170-138529192 CTTTGCCAGAAAAGGAATCAGGG - Intergenic
1049067142 8:140325810-140325832 CTTAGACAGTAAAAGTAGCATGG + Intronic
1050410085 9:5354554-5354576 GTGGGGCAGAAAAAGTATCAAGG + Intergenic
1054703291 9:68435873-68435895 CTGTGGCAGTAAGAGTGACAAGG - Intronic
1054769626 9:69071333-69071355 CTTGGGCAATAAAAGTATCAAGG - Intronic
1056221239 9:84452433-84452455 CTGTGACAGGAAAAGTGACAAGG - Intergenic
1059980768 9:119769492-119769514 CTGTGACAGAAAAAATATGATGG - Intergenic
1190027331 X:46936568-46936590 ATTTGCCAGTAAAACTATCTGGG + Intronic
1193668479 X:84353682-84353704 CTCTGCCAGTAACAATCTCAGGG - Intronic
1195577395 X:106467387-106467409 CTGTGCCAATAGAAGTTGCAAGG + Intergenic
1198420147 X:136463526-136463548 CTTTACCAGTAAAATTATCTAGG + Intergenic
1198737520 X:139803526-139803548 CTGTGCCAGAAAGTGTATGAGGG + Intronic
1199496063 X:148453664-148453686 CTGTGCCAAACAATGTATCAGGG + Intergenic
1202365883 Y:24164394-24164416 CTGTGGCAGTAAATGTATCCTGG + Intergenic
1202374570 Y:24222186-24222208 CTGTGGCAGTAAATATATCCTGG - Intergenic
1202496210 Y:25447934-25447956 CTGTGGCAGTAAATATATCCTGG + Intergenic
1202504899 Y:25505728-25505750 CTGTGGCAGTAAATGTATCCTGG - Intergenic