ID: 1124856084

View in Genome Browser
Species Human (GRCh38)
Location 15:33390729-33390751
Sequence CTAGATTCCCAGAACTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124856084_1124856087 3 Left 1124856084 15:33390729-33390751 CCTGCTTAGTTCTGGGAATCTAG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1124856087 15:33390755-33390777 AGCGGTACTTGCTAGTCAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 44
1124856084_1124856086 2 Left 1124856084 15:33390729-33390751 CCTGCTTAGTTCTGGGAATCTAG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1124856086 15:33390754-33390776 GAGCGGTACTTGCTAGTCAGAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124856084 Original CRISPR CTAGATTCCCAGAACTAAGC AGG (reversed) Intronic
901767851 1:11515286-11515308 CTAGAGTCCCTGACCTCAGCTGG - Intronic
901946852 1:12711221-12711243 AAAGAATCCCAGAACTAAGAGGG - Intergenic
908357264 1:63334928-63334950 CTTGATTCTCAGAACAAACCTGG - Intergenic
911191203 1:94950149-94950171 CTGGCTTCCCAGAAGAAAGCAGG + Intergenic
911197372 1:95008200-95008222 CTAGATTCCCCACAGTAAGCAGG + Intronic
915116539 1:153604556-153604578 CTTGATTCACAGGAATAAGCAGG - Intergenic
917171414 1:172179693-172179715 CTGTATTCCCAAAACTATGCTGG - Intronic
917312102 1:173689212-173689234 AAAGAATCCCAGAACTAAGAGGG - Intergenic
918994216 1:191735370-191735392 CTAGTTGTCCAGAACTAATCTGG + Intergenic
919328645 1:196140327-196140349 CTTGATTCACAGGAATAAGCAGG + Intergenic
1063279983 10:4617690-4617712 CTAGATTCCCAGGAATAAGCTGG + Intergenic
1065422675 10:25564325-25564347 CTAGATTCCCAGAAATATATTGG + Intronic
1066009084 10:31176930-31176952 GCAGATTCCCTGCACTAAGCAGG + Intergenic
1066251246 10:33634741-33634763 CTAGATTCAGAGAAGTAAGGAGG + Intergenic
1067964098 10:50889436-50889458 CTAGATTCCCAGCATTATCCAGG + Intergenic
1069566478 10:69466692-69466714 CTACATTCCCAGAAAAGAGCTGG - Intronic
1070291357 10:75117298-75117320 CTATAGTCCCAGAACTCAGGAGG + Intronic
1073479460 10:103777382-103777404 CTAGATGCCCAGAGCCAAGCTGG - Intronic
1073650209 10:105350952-105350974 CTGCTTTCCCAGAGCTAAGCTGG - Intergenic
1077276712 11:1714840-1714862 CTGGACTCTCAGAACTTAGCGGG - Intergenic
1080581951 11:33651523-33651545 CTAGATTCGAAGAACTATGGAGG + Intronic
1080917166 11:36672023-36672045 CTTGATTCACAGGAATAAGCAGG - Intergenic
1081522149 11:43892717-43892739 CAAGATTCCAGGAACTAAACAGG - Intronic
1081539981 11:44027337-44027359 CTAGATTCCCAGAAATAAATTGG + Intergenic
1082019503 11:47520072-47520094 CTATATACCCAGAACTAAAGAGG + Intronic
1082228478 11:49736416-49736438 CTTGATTCACAGAAATAAGCAGG + Intergenic
1082252764 11:50000492-50000514 CTTGATTCACAGGAATAAGCAGG - Intergenic
1083518978 11:63289400-63289422 CTGGATTCCCAAAACTAACATGG + Intronic
1084398057 11:68927550-68927572 CTAGATTCCCAGGAATATGTTGG + Intronic
1086058632 11:82677294-82677316 CTTGATTCACAGGAATAAGCAGG + Intergenic
1086534639 11:87830221-87830243 CTATAATCCCAGAACTTAGGAGG + Intergenic
1086621592 11:88892732-88892754 CTTGATTCACAGAAATAAGCAGG - Intronic
1087958118 11:104315305-104315327 CTATATTCCCAAGACTGAGCAGG - Intergenic
1088598388 11:111456225-111456247 CGGGATTCCCAGGACTCAGCAGG - Intronic
1090752634 11:129760630-129760652 CCAGAGTCCCAGAACAATGCAGG + Intergenic
1092315451 12:7408675-7408697 ATAGATTCCCAGAAATAATGTGG + Intronic
1094119599 12:26956595-26956617 CTGGATTCCCATAACTAACGTGG - Exonic
1095573043 12:43704312-43704334 CTTGATTCACAGGAATAAGCAGG - Intergenic
1096162394 12:49389704-49389726 CTGGATTCCCATAACTAACGTGG - Intronic
1097036304 12:56126733-56126755 CCATATTCCCAGAGGTAAGCAGG - Exonic
1098167543 12:67713802-67713824 CTTGATTCACAGGAATAAGCAGG - Intergenic
1101322362 12:103683958-103683980 CTAGATTCCCAGAGCTACCCTGG - Intronic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1102622441 12:114206930-114206952 CTAGATTCCTAGCACATAGCAGG + Intergenic
1103585147 12:121947544-121947566 CTGGAATCCCAGAACTTTGCAGG - Intronic
1106054032 13:26221823-26221845 CTAGATTCTCACAAGGAAGCAGG + Intronic
1106623177 13:31390744-31390766 CTTGATTCACAGGAATAAGCAGG + Intergenic
1106663561 13:31827423-31827445 CAACATTCCCAGAACTTGGCAGG - Intergenic
1106722874 13:32454049-32454071 CTAGATTCCCAGGAATATGTGGG - Intronic
1109209235 13:59515439-59515461 CTTGATTCACAGAGATAAGCAGG - Intergenic
1109293482 13:60502288-60502310 CTTGATTCACAGGAATAAGCAGG + Intronic
1115412941 14:33096013-33096035 CTAGATTAACAAAATTAAGCTGG - Intronic
1117637512 14:57760470-57760492 CTGGATAGCCAGAACAAAGCTGG - Intronic
1119030104 14:71185578-71185600 CTAGCTCCCTAGAAATAAGCTGG - Intergenic
1121711324 14:96040658-96040680 CTAGACCCCCAGAACTAACTTGG - Intronic
1122056150 14:99099557-99099579 GGAGATTCCCAGCACCAAGCCGG + Intergenic
1122333342 14:100944249-100944271 CTATATTCCCACACCTAACCAGG - Intergenic
1123460249 15:20463844-20463866 CTAGCTTCACAGAACTAAAGCGG + Intergenic
1123657813 15:22536573-22536595 CTAGCTTCACAGAACTAAAGCGG - Intergenic
1124266470 15:28239573-28239595 CTAGCTTCACAGAACTAAAGCGG + Intronic
1124311722 15:28631771-28631793 CTAGCTTCACAGAACTAAAGCGG - Intergenic
1124856084 15:33390729-33390751 CTAGATTCCCAGAACTAAGCAGG - Intronic
1131079750 15:89524816-89524838 TTAGATTCCCAGAAGAAAGAAGG - Intergenic
1136704664 16:32177019-32177041 CTAGCTTCACAGAACTAAAGCGG + Intergenic
1136763249 16:32752387-32752409 CTAGCTTCACAGAACTAAAGCGG - Intergenic
1136804851 16:33117999-33118021 CTAGCTTCACAGAACTAAAGCGG + Intergenic
1137794874 16:51207636-51207658 CTATAATCCTAGGACTAAGCAGG - Intergenic
1139508814 16:67414773-67414795 CTAGATTGGCAGAACTAGGATGG + Intronic
1203065400 16_KI270728v1_random:1012709-1012731 CTAGCTTCACAGAACTAAAGCGG - Intergenic
1143566850 17:7727302-7727324 CTACATTCCCAGATCAAAGGTGG + Intronic
1148377294 17:47159876-47159898 GTAGATTCCCATCACCAAGCTGG - Intronic
1148643524 17:49205809-49205831 CTACATTCCCAGTCCTTAGCAGG + Intronic
1149306432 17:55351279-55351301 CTAGATTCCCAGAAATACCCTGG - Intergenic
1149424987 17:56546137-56546159 CTACATTCCCATAACCTAGCAGG + Intergenic
1150657292 17:67047781-67047803 CTAGATTCCCAGGAATATGTTGG - Intronic
1152311611 17:79554629-79554651 CTAGACATCCAGAACTGAGCAGG - Intergenic
1157044253 18:44079833-44079855 ATAGATTGCCAGAATTGAGCTGG - Intergenic
1158508727 18:58070540-58070562 CTAGATTCCCAGGAATATGTTGG - Intronic
1160704288 19:522710-522732 CCAGTTTCCCAGCACTGAGCTGG + Intergenic
1162268326 19:9594363-9594385 AAAGAATCCCAGAACTAAGAGGG - Intergenic
1166324393 19:42040389-42040411 CTGGTATCCCAGAAATAAGCAGG - Intronic
1167472099 19:49680956-49680978 CTGAAATCCCAGAACGAAGCTGG + Intronic
930869765 2:56158881-56158903 CTTGATTCACAGGAATAAGCAGG - Intergenic
935048066 2:99499386-99499408 AAAGAATCCCAGAACTAAGAGGG + Intergenic
935941163 2:108240681-108240703 CTTGATTCACAGGAATAAGCAGG + Intergenic
936755677 2:115708494-115708516 CTAACATCCCAGAACTAAACTGG + Intronic
939843582 2:147217589-147217611 GTAGGTTCACAGAAATAAGCAGG + Intergenic
940235611 2:151508116-151508138 ATAGATTCCAAGAAATAAGGAGG + Intronic
940666127 2:156612111-156612133 CTAGAGTCCCAGCACTCAGGAGG - Intronic
945405968 2:209449019-209449041 TTAGAGTCCCATAACTAACCAGG + Intronic
946240469 2:218351198-218351220 CTTGATTCACAGGAATAAGCAGG + Intergenic
947406973 2:229788467-229788489 CTAGAGTCCCTGACCCAAGCAGG + Intronic
948801059 2:240433840-240433862 CCAGAGGCCCAGAACTAGGCTGG + Intergenic
1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG + Intronic
1172818328 20:37708824-37708846 CTAGAGTCACTGAACTAAGAAGG + Intronic
1178093870 21:29193350-29193372 CTCAATTCCCAGAAGTAAGGAGG + Intergenic
1178836622 21:36104009-36104031 CTTGATTCACAGGAATAAGCAGG - Intergenic
1180987522 22:19913653-19913675 CTAGGTTCCCAGGAATATGCTGG - Intronic
1181784329 22:25215657-25215679 CTAAATTCCCAGAGCTCAGTAGG + Intergenic
1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG + Intronic
950846612 3:16021656-16021678 AAAGAATCCCAGAACTAAGAAGG - Intergenic
951953737 3:28230546-28230568 ATACATTCACAGAAATAAGCAGG + Intergenic
954390125 3:50264360-50264382 CAAGATGCCCAGAGCTAAGGTGG + Intergenic
956086034 3:65610343-65610365 CTAGATTCCCAGAATTAGCTAGG + Intronic
961912242 3:130330040-130330062 CTTGATCCCCAGAACAATGCTGG - Intergenic
964165790 3:153703893-153703915 CCAGATTCCCAGATCCAACCAGG + Intergenic
964178699 3:153857332-153857354 CTGTATTCCCAGAACTATGGGGG + Intergenic
966561493 3:181325331-181325353 CTAGATTTCAAGCACAAAGCTGG - Intergenic
967542470 3:190683646-190683668 CTTGATTCACAGGAATAAGCAGG - Intergenic
968015567 3:195329352-195329374 ATAGGTTCCTATAACTAAGCAGG + Intronic
968543381 4:1180034-1180056 CTAGATTCTCAGAAATAGGTTGG - Intronic
971969081 4:33598682-33598704 CTTGATTCTCAGGAATAAGCAGG - Intergenic
973207117 4:47573133-47573155 CTGTCTTTCCAGAACTAAGCTGG + Intronic
976247737 4:83020601-83020623 CTAGGTTCACAGATCTAGGCTGG + Intergenic
981561664 4:146055012-146055034 CTAGATTCCCTGAACAACCCAGG - Intergenic
982031402 4:151304732-151304754 CTAGATTCCCAGGAATATGTGGG - Intronic
984516133 4:180742382-180742404 GTAGATTCCCATAATCAAGCAGG - Intergenic
984789269 4:183600059-183600081 GTAGATTCCCAGGAATATGCAGG + Intergenic
987845876 5:23284629-23284651 CAAGATTGCCAGAATTAACCAGG - Intergenic
990654063 5:57935122-57935144 CCAGACTCCCAGAAGGAAGCAGG - Intergenic
992347491 5:75894787-75894809 CTAGATTCCCAGGAATGTGCAGG - Intergenic
993118861 5:83750571-83750593 CTAGATTCCCAGAAATATGTTGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
998345383 5:141457452-141457474 CTTGATTCACAGGAATAAGCAGG + Intronic
1000069576 5:157727481-157727503 CTTGATTCACAGGAGTAAGCAGG + Intergenic
1000234153 5:159342168-159342190 CTACATTCACAGAATTTAGCTGG - Intergenic
1001449811 5:171815947-171815969 AGAGATTCCCAGAAATAACCAGG + Intergenic
1005351876 6:24944085-24944107 CTAGATTCCCAGGAATATGTGGG - Intronic
1006231680 6:32593422-32593444 CAACATTCCCAGGACTAAACAGG + Intergenic
1006766079 6:36508384-36508406 CTGTATTCCCAGACCTAACCGGG + Intronic
1007952276 6:45883078-45883100 CTTGAATCCCAGAGCCAAGCTGG - Intergenic
1009218267 6:60949115-60949137 CATGATTCCCAAAGCTAAGCAGG - Intergenic
1009650937 6:66477765-66477787 CTATATTCCCAGATATAAACAGG + Intergenic
1012617740 6:101298030-101298052 CTATATTCCCAGAAGCATGCTGG + Intergenic
1013725583 6:113091607-113091629 CTACATTCCCAGAAATACCCAGG - Intergenic
1016062178 6:139642530-139642552 CTAGATTCCCAGCAATGTGCTGG + Intergenic
1016181213 6:141150235-141150257 CTTGATTCACAGGAATAAGCAGG + Intergenic
1017135166 6:151141610-151141632 CTGCATGCCCAGGACTAAGCAGG + Intergenic
1019714691 7:2533187-2533209 CTAGGTTCCCACAACTGAGAAGG + Intergenic
1019741628 7:2677866-2677888 CTAGGTTCCCACAACTGAGAAGG - Intergenic
1021032592 7:15756203-15756225 CTAGATTCCCAGGAATATGTTGG - Intergenic
1021274070 7:18627324-18627346 ATAGATTCTCAGAACTTAGATGG - Intronic
1022182369 7:27933766-27933788 CAAGCTTGCCAGAACTCAGCAGG - Intronic
1023610379 7:41965753-41965775 TTAAATTCCCAGAACCAAGCAGG - Exonic
1023782319 7:43668604-43668626 CTTGATTCACAGGAATAAGCAGG - Intronic
1023789602 7:43742928-43742950 GTAGATTCCCAGAAGTAGGATGG - Intergenic
1023967495 7:44970520-44970542 CGAGCTTTCCAGAACTAAGTGGG + Intronic
1024175939 7:46841240-46841262 TTAGTTTCCCATCACTAAGCAGG - Intergenic
1024388204 7:48777426-48777448 TTAGATTCCCAGAATTTGGCAGG + Intergenic
1025639588 7:63354033-63354055 CTACAATCCCAGCACTAAACAGG - Intergenic
1025643111 7:63394059-63394081 CTACAATCCCAGCACTAAACAGG + Intergenic
1027689641 7:81327729-81327751 CTAGATTCCCAGGAATATGATGG + Intergenic
1027877270 7:83787101-83787123 CCAGATACTCAGAAATAAGCAGG - Intergenic
1028700343 7:93771139-93771161 CTAGATTCCCAGGAATATGTAGG - Intronic
1033097998 7:138447685-138447707 AAAGAATCCCAGAACTAAGAGGG - Intergenic
1035026734 7:155831267-155831289 CTAAATTGCCAGAACGAAGGAGG - Intergenic
1039675481 8:39661029-39661051 CTAGAATCCCAAAAGGAAGCAGG - Intronic
1040526752 8:48232462-48232484 CTTGATTCACAGGAATAAGCAGG - Intergenic
1040634100 8:49252420-49252442 CAATATTCCCAGAACCCAGCTGG - Intergenic
1045814979 8:106269336-106269358 GTAGATTCCCAGACCTGAACTGG - Intergenic
1052026560 9:23579880-23579902 CTAGATGTCCAGAAGAAAGCAGG + Intergenic
1052215420 9:25961134-25961156 CTTGATTCACAGGAATAAGCAGG + Intergenic
1052894190 9:33731905-33731927 CCAGAGTCCCAGAACAATGCAGG + Intergenic
1053082392 9:35187387-35187409 CTTGATTCACAGGAATAAGCGGG + Intronic
1055006102 9:71508771-71508793 CTTGATTCACAGGAATAAGCAGG + Intergenic
1055336120 9:75235274-75235296 CTAGATTCCCTCTACTAAGAGGG - Intergenic
1055785501 9:79865332-79865354 CTGTATTCCCAGAACCAAGGAGG - Intergenic
1056414838 9:86366298-86366320 AAAGAATCCCAGAACTAAGCGGG - Intergenic
1059267889 9:113052724-113052746 CCAGACTCCCAGAAGAAAGCAGG + Intronic
1059720828 9:116958760-116958782 CAAGATACCTAGAAATAAGCCGG + Intronic
1060160118 9:121354582-121354604 CTAGAATCCCAGTACTGACCAGG + Exonic
1060531985 9:124353093-124353115 CTTGGTTCTCAGAACTGAGCTGG + Exonic
1061133787 9:128722162-128722184 CTCCATACCCAGAGCTAAGCCGG - Intronic
1185976662 X:4728719-4728741 CTATATTCCCAGCACTTTGCTGG + Intergenic
1186757315 X:12685788-12685810 CTACAAGCCCAGACCTAAGCAGG - Intronic
1188461873 X:30436624-30436646 CCAGATTCAAAGCACTAAGCAGG - Intergenic
1189034270 X:37479737-37479759 AAAGAATCCCAGAACTAAGGAGG + Intronic
1189184945 X:39046520-39046542 CTAGAGTTCCAACACTAAGCTGG - Intergenic
1189834167 X:45004168-45004190 AAAGAATCCCAGAACTAAGGAGG - Intronic
1190723072 X:53167276-53167298 CTTGATTCACAGGAATAAGCAGG - Intergenic
1192765565 X:74136629-74136651 CTTGATTCACAGGAATAAGCAGG - Intergenic
1195177613 X:102326320-102326342 CTTGATTCCCAGACCTCACCTGG - Exonic
1195181251 X:102360773-102360795 CTTGATTCCCAGACCTCACCTGG + Exonic
1195203354 X:102571271-102571293 CTTGATTCCCAGATCTCACCTGG - Intergenic
1197007232 X:121515817-121515839 TTAGATTGCCAGAACTCAGATGG + Intergenic
1198183573 X:134233336-134233358 CTAGAAGCCCAAAACTAAGGTGG - Intergenic
1200037399 X:153340940-153340962 CCAGAGTCCTAGAACTCAGCAGG - Intronic