ID: 1124862019

View in Genome Browser
Species Human (GRCh38)
Location 15:33450988-33451010
Sequence GGGTTGTTTCAGGTGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124862019_1124862025 14 Left 1124862019 15:33450988-33451010 CCTTGCAGCACCTGAAACAACCC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1124862025 15:33451025-33451047 CAAATCTGTGCTGGCAAACCTGG 0: 1
1: 0
2: 0
3: 13
4: 174
1124862019_1124862024 5 Left 1124862019 15:33450988-33451010 CCTTGCAGCACCTGAAACAACCC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1124862024 15:33451016-33451038 TGTTAGAGGCAAATCTGTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 135
1124862019_1124862021 -9 Left 1124862019 15:33450988-33451010 CCTTGCAGCACCTGAAACAACCC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1124862021 15:33451002-33451024 AAACAACCCAATGTTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124862019 Original CRISPR GGGTTGTTTCAGGTGCTGCA AGG (reversed) Intronic
900363601 1:2301508-2301530 GGGTGGGTGCACGTGCTGCAGGG + Intronic
901387872 1:8923057-8923079 GCCTTGTTTCAAGTGCAGCAAGG + Intergenic
901880019 1:12188394-12188416 GGGATGTTTCAGGTGCAGGAGGG + Intronic
902547884 1:17201639-17201661 GGGTTGTTCCAGGGGCTTCCTGG + Intergenic
902711716 1:18244421-18244443 GGGTTGTTGCAGGTGATGCTGGG + Intronic
903128467 1:21263194-21263216 GGGCTGGTTCTGGGGCTGCAGGG - Intronic
903831757 1:26179436-26179458 AGGGTGTTCCAGGAGCTGCAAGG + Intronic
906333301 1:44906378-44906400 GCTTTGTTTCAGCTTCTGCATGG + Intronic
906797293 1:48708324-48708346 GGGTTGTGTCAGGGACTGCAGGG + Intronic
907002702 1:50877944-50877966 AGGTTGTTTCAGCAGCTGCTAGG - Intronic
907490967 1:54808593-54808615 GTGTTATTCCAGGTGCTGCCGGG + Intronic
908633426 1:66135982-66136004 TGGTTGTTTCAGATGTTTCAAGG + Intronic
910029915 1:82706522-82706544 GCTTTCTTCCAGGTGCTGCAGGG - Intergenic
912581595 1:110725864-110725886 ATGTTGTTCTAGGTGCTGCAAGG - Intergenic
913196822 1:116463831-116463853 GGAGTGGTTCAAGTGCTGCAAGG + Intergenic
913716587 1:121540696-121540718 GGTTTGTTTCAGAAGCTGCTAGG + Intergenic
914404628 1:147358410-147358432 GAGTTGTTGGAGGTCCTGCAGGG - Intergenic
916507251 1:165439362-165439384 GGGTTGCTTCCGGTGCTTGAAGG - Intronic
917169234 1:172151690-172151712 GGGTGGTCTCAGGTGCTTCCTGG + Intronic
918050675 1:180969984-180970006 GGGTTGTTTCAGCAGCTGATGGG - Intergenic
920060498 1:203223788-203223810 GGGCTGCTTCAGAGGCTGCAGGG + Intronic
921465379 1:215481159-215481181 TGGTTGTCTCAGGTCCTTCAAGG - Intergenic
921665638 1:217867625-217867647 GGGCTGTGTCAGATCCTGCATGG + Exonic
1062904837 10:1172951-1172973 GGTTTGTGTGAGGTGCTGGAGGG + Intergenic
1069752986 10:70756720-70756742 AGGTTGTTTCAGCAGCTGCTAGG + Intronic
1071108516 10:82127138-82127160 GGGTGGCTGCAGGTGCTGCAAGG + Intronic
1073469925 10:103716164-103716186 GGGCTGGTTAAGGTGGTGCAGGG - Intronic
1075727811 10:124619498-124619520 AGGCTGTTTCTGGGGCTGCAGGG - Exonic
1076810995 10:132886296-132886318 GGGTCCTTTCAGGAGTTGCATGG + Intronic
1076828965 10:132984884-132984906 GTGCTGTTCCAGGTGCTGAAGGG + Intergenic
1077185868 11:1235077-1235099 CGGTTCCTGCAGGTGCTGCAAGG - Exonic
1078045576 11:7911579-7911601 TGGTTGCTTCAGGTGTTGCCTGG - Intergenic
1078434842 11:11315853-11315875 TGGTTGTTTGAGGGGGTGCAGGG - Intronic
1078858331 11:15224745-15224767 GGGATGTGTCAGGTGGTGGAAGG + Intronic
1079452320 11:20607586-20607608 GGGTTGTTGCAGGAGCCCCAGGG - Exonic
1081743885 11:45459639-45459661 GGGTTGTTTCAGCAGCTGCCTGG + Intergenic
1083679293 11:64343876-64343898 GGGCTGCTTCAGGTGCTTCAGGG + Exonic
1083768118 11:64851966-64851988 TGGATGCTTCAGTTGCTGCAGGG - Exonic
1085617686 11:78013901-78013923 GATTTGTTTCAGGTGTTGCCTGG + Intergenic
1086514432 11:87595570-87595592 GGGTTGGTTCAGATGCCCCACGG + Intergenic
1089033276 11:115356456-115356478 GGTCTGTGTCAGGTGCTGGAGGG - Intronic
1089092699 11:115891478-115891500 GGGTTGATTCAGGTAATGCTTGG + Intergenic
1090682620 11:129077622-129077644 GGGTTGCTGCAGGTGCTGTGGGG - Intronic
1095285746 12:40408087-40408109 ATGTTGTTTCAAGTGCTGCTAGG + Intronic
1096371222 12:51070739-51070761 GGGTTGTTCCAGCAGCTGCTTGG - Intronic
1097140739 12:56900706-56900728 GGGGAGCTCCAGGTGCTGCATGG - Intergenic
1098387744 12:69936445-69936467 GGGATGTATTAGGTGCTGCAAGG - Exonic
1105506495 13:21014610-21014632 AGCTTGTTTCAGTTGCTGCATGG - Intronic
1108436944 13:50410235-50410257 TGGTTATTTCAGCTGCTGCTAGG + Intronic
1110593974 13:77297500-77297522 AGGTTGTTCCAGATGCTGAAGGG + Intronic
1113769216 13:112897929-112897951 GGGCTGTCTCTGATGCTGCAGGG - Intronic
1113949933 13:114066291-114066313 GAGGTGTCTCAGCTGCTGCAGGG - Intronic
1115460044 14:33650310-33650332 AGGATGTTTGAGATGCTGCAGGG + Intronic
1115850888 14:37588983-37589005 GGATTTTTTCAAGTGCTACATGG + Intergenic
1116593976 14:46816395-46816417 AGGTTATTTCAGGTAGTGCACGG - Intergenic
1119073001 14:71606594-71606616 TGTTTGTTTCAGGGCCTGCAAGG + Intronic
1121707999 14:96014554-96014576 AGGTTGTTTCAGCAGCTGCTAGG - Intergenic
1122556043 14:102580606-102580628 GGGTTGTTCCAGGAGCATCAGGG + Intergenic
1123939207 15:25208664-25208686 GGGTTTTTTCAGCCCCTGCAGGG + Intergenic
1124862019 15:33450988-33451010 GGGTTGTTTCAGGTGCTGCAAGG - Intronic
1126251715 15:46575252-46575274 GGGGTGTTTCTGATGCTACAGGG - Intergenic
1128729824 15:70013658-70013680 GGGTGGTTTTGGGGGCTGCAGGG + Intergenic
1129220789 15:74130533-74130555 GGTTTGTCTCACGTGTTGCAGGG + Exonic
1129868440 15:78925999-78926021 GGTTTTTTTAAGGTTCTGCATGG - Intronic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG + Intronic
1130662676 15:85843004-85843026 GGGCTGGAGCAGGTGCTGCATGG + Intergenic
1133075170 16:3274614-3274636 GGGGTGTTTAAGCTGCTGCTTGG - Intronic
1135904132 16:26494970-26494992 GAGGTGATTCAGGTTCTGCAAGG + Intergenic
1136222733 16:28838663-28838685 GGGGTGGTGCAGGAGCTGCAAGG + Intergenic
1137286223 16:47017857-47017879 GAGTAGTTTCAGGTGGGGCATGG + Intergenic
1138470795 16:57234154-57234176 GGTGTGTTTCAGGAGCAGCAAGG - Intronic
1140689972 16:77472666-77472688 GGTTTGTTTCAGGTGTTTCAAGG - Intergenic
1141110564 16:81267747-81267769 AGGTTGCTGCAGCTGCTGCAGGG - Intronic
1143259706 17:5588903-5588925 GGGTTGTTTCAGATTGTGAATGG + Intronic
1146836897 17:36118243-36118265 GGGGTGGATCAGGTGCTGGAAGG + Intergenic
1147010257 17:37440600-37440622 TGCTTGTTTCAGGTTCAGCAGGG - Exonic
1148162096 17:45456092-45456114 GGGATGTTTGAGGAGATGCAAGG - Intronic
1148188737 17:45663980-45664002 GGGCAGTGTCAGTTGCTGCATGG + Intergenic
1149743170 17:59067864-59067886 GTATTGTTGTAGGTGCTGCATGG - Intronic
1152763066 17:82119635-82119657 GGGTGCCTGCAGGTGCTGCAAGG + Intronic
1152887519 17:82861074-82861096 GCTTTGTCCCAGGTGCTGCAGGG + Intronic
1155493604 18:26422410-26422432 GGGCTGTTTCAGGAGGTGCTGGG - Intergenic
1156554031 18:38047239-38047261 GGACTGTTTCAGGGGCTGGAAGG - Intergenic
1157000378 18:43515604-43515626 TGGTTGTTCCCGGTGTTGCAAGG + Intergenic
1158366686 18:56744651-56744673 AGGTGATTTCAGGTGCAGCATGG - Intronic
1162480782 19:10925869-10925891 GAGTTCTTTCAGGTGGGGCATGG - Intronic
930401689 2:50897454-50897476 GGATTATTTTAGGTGCTGAAGGG + Intronic
930688085 2:54330600-54330622 GGGCTGTTTCCGGAGCTGCGGGG - Intronic
931429765 2:62198863-62198885 GGGCTTTTTCAGCTGATGCAGGG + Intronic
931664640 2:64601408-64601430 GGGTTGTAGCTGTTGCTGCATGG - Intergenic
932219412 2:69988491-69988513 CGGTGGTTGCAGGAGCTGCAGGG + Intergenic
938794092 2:134704146-134704168 TGCTTCTTTCAGGTGCTCCAGGG + Intronic
943055616 2:182974663-182974685 GGTTTGTTTCAAGGACTGCAAGG - Intronic
946095383 2:217270120-217270142 GGGCTGTGTCAGGTCCAGCAAGG - Intergenic
946266321 2:218545106-218545128 GGGTTATTTCAGTGGCTGTAGGG + Intronic
948500111 2:238386219-238386241 GGGTTGTTTCAGTGGCTTCTAGG + Intronic
948603648 2:239121386-239121408 GGGCTGTTTCAGGGGCCCCAAGG + Intronic
1169971819 20:11276886-11276908 GGCATGCTTCAGGTGCTGCAGGG + Intergenic
1170953043 20:20953973-20953995 GGGTGTTTGCAGGAGCTGCAAGG - Intergenic
1171185779 20:23123141-23123163 AGCTTGTTTGAGCTGCTGCAGGG + Intergenic
1174048060 20:47747888-47747910 GGGTGGATTCCGGTGCTGCTTGG - Intronic
1174568797 20:51486331-51486353 GGCTTGTTCCAGGAGCAGCAAGG - Intronic
1175500331 20:59445610-59445632 GGGATGTGTAGGGTGCTGCAGGG - Intergenic
1175963866 20:62650393-62650415 GGGGAGTTTCAGGGGCTGGAAGG - Intronic
1176096720 20:63347698-63347720 GGGTTGTCTCAGGTCCTACACGG - Intronic
1178501129 21:33126320-33126342 GAGTTATTTCAGATGCTGTATGG - Intergenic
1180038311 21:45262423-45262445 GGGTTGTCTTAGCTGCTGCAAGG - Intergenic
1181526700 22:23493644-23493666 GGGGAGCTTCAGGTGCTGCGAGG - Intergenic
1181595828 22:23913870-23913892 GGGTGGTCTCGGGAGCTGCAGGG - Intergenic
1184113077 22:42406509-42406531 GGGGTGTCCCAGGAGCTGCATGG - Intronic
1184510383 22:44929939-44929961 GCCTGGTTGCAGGTGCTGCAGGG - Intronic
1185321539 22:50202293-50202315 GGGGCATTTCAGGTGCTGGAGGG - Intronic
950679246 3:14573675-14573697 GGGTTGTTTCTGGTGCAGATCGG + Intergenic
954861772 3:53696361-53696383 GGGTAGATTCAGCAGCTGCATGG + Intronic
956799785 3:72746611-72746633 GGGTTGTTTAATGAGCTGCCTGG + Intergenic
967193775 3:187008929-187008951 AGGTTGTTTCAGGTTATGCATGG + Intronic
975226644 4:71880326-71880348 GGGTTAATTCAGTTTCTGCAAGG + Intergenic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
980286337 4:130782890-130782912 GGGTTATTACAGGTACTGGATGG - Intergenic
984011850 4:174381044-174381066 GGGTTGTTTCCCCTGCTGCTTGG + Intergenic
984234287 4:177137339-177137361 GGGTTGTTGCAGCTGCTGTGGGG - Intergenic
988592162 5:32558260-32558282 GGGTTGTTTCTGCTGCTGTGTGG - Intronic
989173368 5:38495409-38495431 GGGTTGTGGCAGGTGCTGGGAGG - Intronic
989961968 5:50427001-50427023 GGTTTGTTTCAGAAGCTGCTAGG - Intronic
991669788 5:69036527-69036549 GTGTTGTTTCAGGGACTCCAGGG + Intergenic
993039798 5:82801119-82801141 GGATTGTTTTAGGGGCTGGATGG + Intergenic
994184521 5:96803549-96803571 GGGGTGTTCCAGGACCTGCAGGG + Exonic
997254199 5:132415216-132415238 AGGTTATTTCAGGTGGCGCAGGG + Intronic
997728576 5:136144812-136144834 TGGTACTTTCAGGTGCTCCAGGG - Intronic
997860046 5:137407988-137408010 GGTCTGTTGCAGGGGCTGCAAGG - Intronic
998557732 5:143141991-143142013 GGGTTATTACAGGTGCTGCAGGG + Intronic
999905824 5:156140602-156140624 GGAGTGTTTAGGGTGCTGCATGG + Intronic
1000117650 5:158168582-158168604 TGGTCTTTTCAGGTGCTGAATGG - Intergenic
1001723950 5:173880862-173880884 GGGTGGTTGCTGGTGCTGGAAGG - Intergenic
1002173789 5:177390153-177390175 GGGCTGGTTCAGGTCCAGCATGG - Intronic
1003477963 6:6502372-6502394 GTGTTGTTGGAGGGGCTGCAGGG - Intergenic
1005490075 6:26339859-26339881 GTGTTGATGCAGGTGCTGCATGG - Intergenic
1011950784 6:92960795-92960817 GGGTTGTTCCAGCTGAAGCAAGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016838584 6:148504252-148504274 GGGGTGTTTGAGATGCTGCAAGG + Intronic
1017973908 6:159337830-159337852 TGGTAGTTTCAGGTTTTGCAAGG - Intergenic
1018817316 6:167343208-167343230 GGGCTGTGTCAGGATCTGCAAGG + Intronic
1020854482 7:13400324-13400346 GTGTTGTTTCTGGTGCTGCATGG - Intergenic
1021516830 7:21498526-21498548 GGGGTGTTTCAGGAACTACATGG + Intronic
1022036955 7:26543619-26543641 GGGTTGTTGCAGTTGCTGATAGG + Intergenic
1026465538 7:70650355-70650377 GGTTTTGTTCAGGTACTGCATGG - Intronic
1032145445 7:129375701-129375723 GGGTTGTTGGAGCTGCTTCAGGG + Intronic
1033684181 7:143623754-143623776 TGGTTCTATCAGCTGCTGCAGGG - Intronic
1033687357 7:143702973-143702995 TGGTTCTATCAGCTGCTGCAGGG - Exonic
1033700431 7:143833869-143833891 TGGTTCTATCAGCTGCTGCAGGG + Intergenic
1035898428 8:3431220-3431242 GGGGAGTTTCAGCTGTTGCATGG - Intronic
1039030123 8:33299662-33299684 GGCTTGCTGCAGCTGCTGCAAGG - Intergenic
1041001753 8:53461191-53461213 GAGGTGTTTCTGCTGCTGCATGG + Intergenic
1043038442 8:75228676-75228698 GGGATGTTTCACGTCCTGGATGG - Intergenic
1044986579 8:97761360-97761382 GGGCTGCCTCAGGAGCTGCAGGG + Intergenic
1051092577 9:13426945-13426967 TGATTGTTTCAGGTGGTGGAGGG + Intergenic
1051831159 9:21278622-21278644 GGGATGTTTCAGATGCTACTGGG + Intergenic
1052852129 9:33384879-33384901 GGGTTCTTACAGGAGCTCCAGGG - Intronic
1059436752 9:114281755-114281777 GGATTGATTCAGGGCCTGCAAGG + Intronic
1060984203 9:127810237-127810259 TGGTTCTGCCAGGTGCTGCAGGG + Intronic
1061832823 9:133306609-133306631 GGGCTGGTTCAGGTGCAGCAGGG - Intergenic
1186718762 X:12280440-12280462 GGGTTTTTTCAGGTTCTAGAGGG - Intronic
1197661457 X:129178523-129178545 GAGTTCCTTCAGGTCCTGCATGG + Intergenic