ID: 1124866018

View in Genome Browser
Species Human (GRCh38)
Location 15:33492021-33492043
Sequence AAGAAGATATGGCCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124866009_1124866018 23 Left 1124866009 15:33491975-33491997 CCAACCTCCATACTTACAGTTCT 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1124866012_1124866018 16 Left 1124866012 15:33491982-33492004 CCATACTTACAGTTCTTCCTGGT 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1124866008_1124866018 24 Left 1124866008 15:33491974-33491996 CCCAACCTCCATACTTACAGTTC 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1124866010_1124866018 19 Left 1124866010 15:33491979-33492001 CCTCCATACTTACAGTTCTTCCT 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1124866014_1124866018 -1 Left 1124866014 15:33491999-33492021 CCTGGTAAGGATGACATGATTGA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124866018 Original CRISPR AAGAAGATATGGCCTGAGGA GGG Intronic
904434801 1:30487455-30487477 AAAATGATAAAGCCTGAGGATGG + Intergenic
905914079 1:41673102-41673124 GAGAAGACAAGGCCTGGGGAGGG - Intronic
906248450 1:44293397-44293419 AAGAAGGAAAGGCCTGAGGCAGG + Intronic
907440153 1:54474005-54474027 AAGATGATAAGGCCTGAACAAGG - Intergenic
909495510 1:76273111-76273133 AAGAAGGTATTGCCTGGGAAAGG + Intronic
909714281 1:78689123-78689145 AAGAAAAAAAGGCATGAGGATGG - Intergenic
910525714 1:88175733-88175755 AAGAACAGAAGGGCTGAGGAAGG - Intergenic
911224324 1:95288666-95288688 AATAAGATAAGGTCTGAGAAAGG - Intergenic
911507253 1:98768380-98768402 AAGAAGACAGGGCCAGAGAAAGG + Intergenic
912245443 1:107957311-107957333 CAGAAGATAAGGCCAGAGAAAGG - Intronic
912676890 1:111689970-111689992 AAGAAAATGTGACCTGAGGCCGG - Intronic
912812300 1:112803439-112803461 AAGAACATATAGGCTGAGGGTGG - Intergenic
914403916 1:147350737-147350759 AAGAGGATATGGCCAGAGGCAGG + Intergenic
916696101 1:167238070-167238092 AAGAATATATGGGCTGGGCATGG - Intronic
918328402 1:183432288-183432310 AAGAAGATATGAAAAGAGGAAGG + Intergenic
919177472 1:194036379-194036401 AAGAACATATGGACACAGGAAGG - Intergenic
921169607 1:212534868-212534890 AAGAAAATATGGGCTGGGCATGG - Intergenic
921552638 1:216556661-216556683 AAGAAGATGTGACTTGAGGCTGG - Intronic
921695504 1:218204587-218204609 AGGAAGACATGGCCAGAGAAGGG - Intergenic
921928412 1:220732734-220732756 AAGAATATGTGGCGAGAGGAAGG - Intergenic
922088128 1:222370331-222370353 AAAGAAATGTGGCCTGAGGACGG + Intergenic
922215853 1:223519586-223519608 TATGAGATATGGCCTGAGGATGG - Intergenic
924190915 1:241551992-241552014 AACAAGGAATGTCCTGAGGAAGG + Intronic
1064148944 10:12847451-12847473 AAGACCATATGCCCTGAGTAAGG + Intergenic
1065785961 10:29215026-29215048 AAAAAGAAATGGACTGAAGATGG + Intergenic
1066104532 10:32145164-32145186 AAGAGGTCTTGGCCTGAGGAAGG + Intergenic
1066128242 10:32363369-32363391 AAGAAAAAATGGGCTGAGCACGG - Intronic
1067142102 10:43666660-43666682 AAAGAGCTGTGGCCTGAGGAGGG - Intergenic
1067329820 10:45304446-45304468 AACAAGAGGTGTCCTGAGGAAGG + Intronic
1069091196 10:64200822-64200844 GCGAGGATATGGCCTGAGGCAGG + Intergenic
1069396545 10:67995762-67995784 AAGAAGATATGAGTTGAGGATGG - Intronic
1070562357 10:77577492-77577514 CATATGAAATGGCCTGAGGACGG - Intronic
1072483627 10:95832906-95832928 ATGAAGATATGTCCTATGGAAGG + Intronic
1073270784 10:102261910-102261932 AAGAAAATATGGGCTGAGCACGG - Intronic
1073505329 10:103982810-103982832 ATGAAGAGATGACCAGAGGACGG + Intronic
1074986841 10:118666731-118666753 AATAGGATGTGGCATGAGGAGGG - Intergenic
1075235899 10:120728356-120728378 GAGAAGATATGGACACAGGAAGG - Intergenic
1075364192 10:121868931-121868953 AAGCAGAAATGGTCTCAGGAAGG + Intronic
1076260397 10:129060366-129060388 TAGAAAATATGGCCACAGGAAGG + Intergenic
1076810490 10:132884125-132884147 AAGCAGGAAGGGCCTGAGGAGGG - Intronic
1079799152 11:24847461-24847483 TAGAAGGCATGGCCTGAGAACGG - Intronic
1080764743 11:35285175-35285197 AAGAAGAAATGACCTGTGGTTGG + Intronic
1081876194 11:46409981-46410003 GAGAAGATAGGGCCTGGAGAAGG - Intronic
1082869411 11:57930389-57930411 AAGAAGACATTTCCAGAGGAAGG + Intergenic
1083274985 11:61591739-61591761 AAGCAGATATGGCAGGAGGCTGG + Intergenic
1083400196 11:62418255-62418277 AAGAAGGAATGGCCAGAAGAAGG + Intronic
1085169459 11:74436477-74436499 AAGAGGATAAGGCCTTAGGGAGG - Intergenic
1085172765 11:74463128-74463150 AGGATGATCTAGCCTGAGGAGGG + Intronic
1085367027 11:75958091-75958113 AAAAAGATATGGCTTGCTGAAGG - Intronic
1085399074 11:76224780-76224802 GAGAAGACAGTGCCTGAGGAAGG + Intergenic
1086453757 11:86941927-86941949 AAGAAGAAATGGAGTAAGGAAGG - Intronic
1087367456 11:97239038-97239060 CACAAGATATGGACTGGGGAAGG + Intergenic
1087434646 11:98099398-98099420 AAGAAGAGTTGCCCTGAGGTGGG - Intergenic
1088152451 11:106761112-106761134 AAGAAGATAAGGCCAGAAGAAGG - Intronic
1088750094 11:112835974-112835996 GAGAAGACATTGCCTGAGCAGGG + Intergenic
1089198250 11:116707835-116707857 GAGACGAGGTGGCCTGAGGATGG + Intergenic
1089476245 11:118765380-118765402 AAGAAAATATGGGGTGAGGTGGG + Intronic
1089989445 11:122845250-122845272 AATAAGATATGGTCTGAGAATGG + Intronic
1090912488 11:131133665-131133687 AAGAGGATTTGGCTTGAGGCTGG + Intergenic
1091416259 12:287951-287973 TAGAAGATCTGGGCTTAGGAAGG - Intronic
1093018920 12:14185177-14185199 AATAAGATAAGGCTTAAGGAAGG + Intergenic
1094498003 12:31001274-31001296 AAGGAGATGTGTCCTGTGGATGG - Intergenic
1096767807 12:53907975-53907997 AGGAAGATTTGGGCTGTGGAGGG + Intergenic
1098502655 12:71211552-71211574 AACTAAATATGGCCTGAGAAGGG + Intronic
1098591411 12:72218393-72218415 AGGAATATATGGTCTGAGAAAGG - Intronic
1099161388 12:79245914-79245936 AAATAGATGTGGCCTGAGCAGGG + Intronic
1099201096 12:79678255-79678277 AAACAGATATGGACAGAGGAAGG + Intronic
1099552794 12:84069327-84069349 ATTAAGATATTGCCTCAGGAAGG + Intergenic
1101008670 12:100427500-100427522 AGGAAGATGAGGACTGAGGATGG + Intergenic
1102593147 12:113972698-113972720 GGGAATATATGGCCTGAGAATGG - Intergenic
1103755654 12:123204576-123204598 AAGAAGATATGACCCTAGGCTGG + Intronic
1104769293 12:131350946-131350968 AAGAAGATGTGGAATGTGGAGGG + Intergenic
1106018010 13:25887327-25887349 AAAAAGAGTTGGACTGAGGAAGG - Intronic
1106435174 13:29717151-29717173 TGGAAGGTATGGCCTAAGGAAGG + Intergenic
1106830025 13:33570925-33570947 AGAAAGATATGGCTTGAGGGAGG + Intergenic
1107121969 13:36805841-36805863 ATGAAGATGTGGGCTGAAGAGGG - Intergenic
1107656646 13:42598454-42598476 AAGAAGAGATGAACAGAGGAAGG + Intronic
1107787226 13:43969237-43969259 AGCAAGAAAGGGCCTGAGGAGGG + Intergenic
1108172380 13:47755203-47755225 AAGAACATATGGGCACAGGAAGG + Intergenic
1108235673 13:48402321-48402343 AAGAACAAATGGCCTGGGGAAGG + Intronic
1108395957 13:49991861-49991883 ATGAAGACAAGGCCAGAGGAAGG - Intergenic
1108929221 13:55794606-55794628 AAAAAAACATGGCCTGAAGATGG + Intergenic
1109011774 13:56958199-56958221 AAGAAGAGTTGGCCTTAGGAGGG + Intergenic
1109522285 13:63529793-63529815 AAGAAGATATTCCATGTGGATGG - Intergenic
1111751797 13:92342144-92342166 AAGAAGATGTGGCCTGATTTAGG - Intronic
1112260245 13:97871159-97871181 AACTAAATATGGCCTGAGAAGGG - Intergenic
1113296465 13:108964294-108964316 AAGAAGATTGGGCCTTAGGTAGG - Intronic
1114528294 14:23379671-23379693 ATGAAGCTCTGGCCAGAGGAGGG + Exonic
1114779578 14:25523037-25523059 AATCAGATAAGGACTGAGGAGGG - Intergenic
1115581416 14:34762758-34762780 AAGAAGATATGGACTGGGCACGG - Intronic
1116319105 14:43436883-43436905 AAGCATATATTGCCTCAGGAAGG - Intergenic
1117582412 14:57165431-57165453 AAAAAAATGTGGCCAGAGGATGG - Intergenic
1118525245 14:66632988-66633010 AAGAAGGCCTGGCCTGAGCAAGG - Intronic
1120250365 14:82055922-82055944 AAGAAAATATGGTCTGTGGCAGG + Intergenic
1120257275 14:82136734-82136756 AAGAAGATATTGCTTGAGCCTGG - Intergenic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121816451 14:96932639-96932661 ATGAAGACATGGTCTGAGGATGG + Intergenic
1122269509 14:100562253-100562275 AGGAAGAGATGTCCTGGGGATGG - Intronic
1122398248 14:101450584-101450606 AGGAACAAATGGCCTGAGAAGGG - Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122986158 14:105212633-105212655 AAGAAGACTTGGCATGTGGAAGG - Intronic
1124111299 15:26791586-26791608 GAGAAGCTTTGGGCTGAGGAAGG - Intronic
1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG + Intronic
1125333362 15:38603711-38603733 AATTAAATCTGGCCTGAGGATGG + Intergenic
1125427453 15:39563638-39563660 AAGATGAAATCGCCTAAGGAAGG + Intergenic
1125622799 15:41079384-41079406 AAGAGAAAAAGGCCTGAGGAGGG + Intronic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126976864 15:54192623-54192645 AAAAAGATATGTCCTGAACATGG - Intronic
1127194897 15:56573558-56573580 AAGAAGACATGGACACAGGAAGG - Intergenic
1127595317 15:60476275-60476297 AAGAAGAGATTGTCTGGGGATGG - Intronic
1128188814 15:65670058-65670080 AAGAAGATATTGCCACAGAATGG + Exonic
1128210096 15:65892583-65892605 AAGAAGATCATGCCTGAGAAGGG + Intergenic
1128396946 15:67236391-67236413 AAGATGGTAAGGCCTGTGGATGG - Exonic
1130661527 15:85834753-85834775 ATGAAGGTAGGGCCTGAGAAAGG - Intergenic
1130760659 15:86816059-86816081 AAGAAGATAAGGCAGGAAGATGG + Intronic
1133235016 16:4383753-4383775 CAGAAGACAGGGCCTGGGGAAGG - Intronic
1134981493 16:18613981-18614003 AAGAACATATGGACACAGGAAGG + Intergenic
1136017041 16:27407029-27407051 CAGAAGATGTTGCCTGAGGTGGG + Intronic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1139797995 16:69498433-69498455 AGGAAGATCTGGCAGGAGGAAGG - Intergenic
1141261002 16:82453835-82453857 AAGCAGTTAAGGCATGAGGAGGG - Intergenic
1142481317 17:219875-219897 AAGAAATAATGGCCTGGGGATGG + Intronic
1143786408 17:9259028-9259050 GAGATTCTATGGCCTGAGGAAGG - Intronic
1144468820 17:15518801-15518823 AAGGTGACTTGGCCTGAGGAAGG - Intronic
1146726878 17:35163646-35163668 AAGAAGCTGAGGCTTGAGGAAGG + Intronic
1148703229 17:49604667-49604689 AAGTAGAGTTGGCGTGAGGATGG - Intronic
1150031322 17:61739098-61739120 AAGAAGATGTGGTCTAAAGAAGG + Intronic
1150613123 17:66749362-66749384 AAGAGGAACTGGCCTGAGGATGG - Intronic
1151337587 17:73449106-73449128 CAGAAGACCTGGCCTGAGAAGGG - Intronic
1151391256 17:73788088-73788110 AAGGAGCTGTGGCCTGGGGAGGG - Intergenic
1151550334 17:74819072-74819094 AAGAAGTTCTGGGCTGAGGATGG - Intronic
1153776806 18:8461721-8461743 AACAAGACAGGGCCTCAGGAAGG - Intergenic
1153933379 18:9898914-9898936 AGGGAGATATGGCATGGGGAAGG + Intergenic
1154472457 18:14717897-14717919 AAAAAGATTTGGCCTCAGTATGG + Intergenic
1156100621 18:33590270-33590292 AGAGAGATATGGCCTGGGGAGGG - Intronic
1157784316 18:50468499-50468521 AAGGAGATGTGACCAGAGGAAGG - Intergenic
1158971484 18:62671768-62671790 AGGAAGATATGGGCTGGGCATGG - Intergenic
1159964807 18:74584772-74584794 AAGCAGCTATGACTTGAGGAAGG - Exonic
1160156440 18:76437315-76437337 AAGAAGATGGGCTCTGAGGACGG + Intronic
1163626646 19:18393972-18393994 AAGCAGAAATGGTCTGAGGCAGG - Intronic
1166750081 19:45160373-45160395 AAGGAGGGATGGCCAGAGGAGGG + Intronic
1168181794 19:54666708-54666730 AAGAACACACAGCCTGAGGACGG + Exonic
926285034 2:11482145-11482167 AAGAAGATCTGGACAGAGGTTGG - Intergenic
927454441 2:23237616-23237638 AAGAAGCTCTGGCCTCCGGAAGG + Intergenic
927665522 2:25029546-25029568 CACAAGATGTGGGCTGAGGAAGG - Intergenic
927683310 2:25154363-25154385 AAGGAGATGGGGTCTGAGGAGGG + Exonic
928387984 2:30885681-30885703 AGGAAGGAATGGCCTCAGGAAGG + Intergenic
928912091 2:36432289-36432311 AATAAAATAAGGCCTAAGGATGG - Intronic
930272405 2:49272070-49272092 AAGAAGAAAGGGACAGAGGAAGG - Intergenic
933495221 2:83041740-83041762 ATGAAGTTATGACCTGAGGCAGG + Intergenic
933974946 2:87501804-87501826 ATGAAGATATCGCCTGAGCATGG + Intergenic
935383479 2:102477631-102477653 AGGAAGATATGAACTCAGGAAGG + Intronic
935539978 2:104337619-104337641 GAGAACACATGGCCAGAGGAAGG + Intergenic
935543161 2:104373417-104373439 ATGAAGCTTGGGCCTGAGGATGG - Intergenic
936318880 2:111449009-111449031 ATGAAGATATCGCCTGAGCATGG - Intergenic
937544571 2:123001400-123001422 ATGAAGACATGCCCTGAGGCTGG + Intergenic
937822478 2:126326392-126326414 AAGAAGAACAGGGCTGAGGAAGG - Intergenic
941018793 2:160386551-160386573 AAAAAGATGTGGCCTTTGGAAGG + Intronic
941309098 2:163908066-163908088 AAAAAGATATGTACTCAGGATGG - Intergenic
941836556 2:170027369-170027391 AAGAAAATATGTCCAGAGAAAGG - Intronic
942150795 2:173074955-173074977 AAGAAGAAATGGGCTGGGCATGG - Intergenic
943830984 2:192461603-192461625 AAGAAGATACTGCTTGAGGCTGG + Intergenic
944651017 2:201830333-201830355 AAGAAGAGAGTGCCTCAGGAAGG + Intronic
945258410 2:207821884-207821906 AAGAAGGAATGGCCAAAGGAGGG - Intergenic
946160358 2:217832025-217832047 AAGAAAATTGGGCCTCAGGATGG + Intronic
946813196 2:223549032-223549054 TAGAAAATATGGCTTGGGGAAGG + Intergenic
948891679 2:240909897-240909919 GAGACCATAGGGCCTGAGGAAGG + Intergenic
1171037800 20:21730009-21730031 AAGAAGGTATGGCAAGAAGAAGG + Intergenic
1173296208 20:41760543-41760565 AAGAAAATAGGGCTTGGGGAAGG - Intergenic
1173563540 20:44023009-44023031 AGGAAGAGAAGGCCAGAGGAGGG + Intronic
1174243942 20:49162169-49162191 AAATAGATAAGGTCTGAGGATGG - Intronic
1174350143 20:49961352-49961374 AAGAAAATATGGACTTATGAAGG + Intergenic
1174995088 20:55557836-55557858 AAGTATAAATGGCCTGAGGCAGG + Intergenic
1175975853 20:62710085-62710107 AAGAAGATAGGGGCTGAGCCTGG - Intronic
1177226900 21:18268686-18268708 AAGAAGGTGTGGCCAGATGATGG - Intergenic
1178341833 21:31792104-31792126 AAGAAGCTATGGAATGTGGAGGG - Intergenic
1178690061 21:34743193-34743215 AAAAGGATTTGGCTTGAGGAAGG - Intergenic
1179463130 21:41551068-41551090 AAGAAGGTTTGACCTGAGGCCGG + Intergenic
1181558463 22:23685645-23685667 AAGAAGATGCGGCCTCAGTAGGG + Intergenic
1181995113 22:26871908-26871930 AGAAAGATATAGCCTCAGGATGG - Intergenic
1182742197 22:32576096-32576118 ATGAAGCAATGGCCTGAGTATGG + Intronic
1184233684 22:43171802-43171824 AAGCAGGTAGGGCCTGAGGGAGG - Exonic
1184324135 22:43769733-43769755 AGGAGGATATGGGGTGAGGAGGG + Intronic
1185211724 22:49574318-49574340 AGGAAGATATGGACGGAGCAAGG + Intronic
1185368927 22:50450222-50450244 AAGAAGCTATGACCTGACGCCGG + Intronic
949935889 3:9115237-9115259 AAGCAGCTAAGGGCTGAGGAAGG + Intronic
950275954 3:11661117-11661139 GAGAAGAAATGCCCTCAGGATGG + Intronic
950284683 3:11735385-11735407 AAGTAAATATGGGCTGAGGCAGG + Intergenic
950353082 3:12376243-12376265 AAGAAAAAATGCCCTGAGGCCGG - Intronic
952597629 3:35037671-35037693 AAGAAGATATGGCCTTTGGGAGG - Intergenic
952657041 3:35799286-35799308 AAGATGATATGACCTCAGCATGG + Intergenic
952888238 3:38024783-38024805 AAGAAAATCTGGGCTAAGGAGGG + Exonic
954335270 3:49912632-49912654 CAGGAGCTATGGCCTGAGTAGGG - Intronic
956833625 3:73077491-73077513 CAGAACATAAAGCCTGAGGAAGG - Intergenic
957190836 3:77007399-77007421 AATAATGTATGGCATGAGGATGG - Intronic
957632894 3:82740791-82740813 AACAAAATATGGCGTGCGGAGGG + Intergenic
958898217 3:99854158-99854180 AAGAAGGTATAGGGTGAGGAGGG + Intronic
959349329 3:105240990-105241012 AAGAATATGTGACCAGAGGATGG + Intergenic
959784160 3:110273495-110273517 AAGAAACTAAGGCCTGAGGATGG + Intergenic
960061977 3:113332416-113332438 AAAATGAAATGTCCTGAGGAAGG - Intronic
960098273 3:113709364-113709386 AATAGGATAAGGCCAGAGGAGGG - Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960818180 3:121695888-121695910 AAAAAGATACGGTCTTAGGAAGG - Exonic
961337756 3:126193169-126193191 AACTAAATATGGCCTGAGAAGGG - Intronic
961697089 3:128712839-128712861 AAGATCAAATGGCCTGAGGAAGG - Intergenic
962367987 3:134798282-134798304 AAGGAGATGTGGCCAGAGGAAGG + Intronic
963247622 3:143077137-143077159 AAGAAGATAGGCAGTGAGGAAGG - Intergenic
963430542 3:145196824-145196846 AAGAAAAGATGCACTGAGGAGGG + Intergenic
963460755 3:145611637-145611659 AAGAAGATATGGATTTAAGAGGG - Intergenic
964631832 3:158818858-158818880 AAGAGGATTTGACCTGATGATGG - Intronic
967036021 3:185648869-185648891 CAGAAGATAGAGCCTGTGGAGGG + Intronic
969051264 4:4374923-4374945 TACAAGAGATGGCCAGAGGATGG - Intronic
969154127 4:5195184-5195206 AAGAAAATATAGTCTGAGGCCGG - Intronic
970054568 4:11956645-11956667 TAGAAGATATGCCCAGAAGAGGG + Intergenic
974378048 4:61103108-61103130 AAGAACATATGGCCTGAAGCTGG + Intergenic
976220752 4:82755108-82755130 AAGAAGATGGGGGGTGAGGATGG + Intronic
977654197 4:99503293-99503315 GAGAAGGGATGGCTTGAGGAGGG - Intergenic
978697614 4:111601076-111601098 AAGAAGATATGGAATGATTAAGG - Intergenic
980460649 4:133107009-133107031 AAGAAGACATGACCTGAGACTGG - Intergenic
982398976 4:154944958-154944980 AACTAAATATGGCCTGAGAAGGG - Intergenic
984445511 4:179831025-179831047 AAAAAGAGATGCCCAGAGGAAGG + Intergenic
984627415 4:182022911-182022933 AAGTGGATAGGGGCTGAGGAGGG + Intergenic
985714849 5:1449998-1450020 AAGGAGGGATGGCCAGAGGATGG + Intergenic
986225917 5:5812557-5812579 AACTAAATATGGCCTGAGAAGGG - Intergenic
986927960 5:12781852-12781874 AAGGAGAAGTGGCCTGAGGTAGG - Intergenic
986972817 5:13356990-13357012 AAGAGGGTATGGCCTGAGCATGG + Intergenic
988202591 5:28086586-28086608 AAGAAGAGAAGAACTGAGGAGGG + Intergenic
991612897 5:68466938-68466960 AGGCAGTTATGGCCTAAGGACGG + Intergenic
992413600 5:76532038-76532060 TAGGAGATATGGCCTGTGGGAGG - Intronic
994683301 5:102917028-102917050 AAGAATATAAGGCCTGTGGCTGG - Intronic
995553102 5:113299884-113299906 GAGAAGACAAGGCCTCAGGAAGG - Intronic
996039020 5:118789810-118789832 AAGAAGGTAGGGGTTGAGGAGGG + Intergenic
997156176 5:131561359-131561381 AAGAAGAAATCACCTGAGGCTGG + Intronic
997358959 5:133282200-133282222 GGGAAGGTAGGGCCTGAGGAGGG + Intronic
997455761 5:134016324-134016346 AAGAAGAACTGGCCTGGGGCTGG + Intergenic
997625104 5:135326350-135326372 AAGAAAACATGCCCTGAAGAGGG + Intronic
1000642146 5:163715661-163715683 AGGAAGATCTGGGCTGAGAAGGG + Intergenic
1001911271 5:175520466-175520488 AAGAAGACATGGCATCAGGTTGG + Intronic
1003381221 6:5626124-5626146 AAGAAGATAATGCCTGAAGGAGG + Intronic
1003592893 6:7450499-7450521 AAGATGAGAAGACCTGAGGAGGG + Intergenic
1004896378 6:20152028-20152050 AAGAAAAAATGGGCTGGGGATGG + Intronic
1005020595 6:21414624-21414646 ATGAAGATATGGCTTGTGGAAGG - Intergenic
1006118031 6:31785632-31785654 AAGAAGCTATGGCGTGAGCAGGG - Exonic
1006275579 6:33002652-33002674 AAAAAGAAATACCCTGAGGACGG + Intergenic
1006819282 6:36878586-36878608 AACTAAATATGGCCTGAGAAGGG + Intronic
1007223719 6:40298431-40298453 TAGAAGCTATGTGCTGAGGAAGG + Intergenic
1007255535 6:40525677-40525699 AAGAAAGTATGGCAAGAGGAAGG - Intronic
1007463720 6:42036728-42036750 AAGAAAATTTGGCCTCAGGCAGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007715747 6:43855093-43855115 ATGAAGAGATGCCCTGGGGAGGG - Intergenic
1009666333 6:66685773-66685795 AACTAAATATGGCCTGAGAAAGG + Intergenic
1010292420 6:74153241-74153263 AAGAAGATATGCCCTCACCAAGG + Intergenic
1010855133 6:80828493-80828515 AAGAACATATGGACACAGGAAGG - Intergenic
1011698340 6:89933096-89933118 ATGAAGAGATGTCCTGGGGAAGG - Intronic
1011830718 6:91368213-91368235 AAGAAAATATGGCATGGGCAGGG - Intergenic
1011978420 6:93337929-93337951 AGGAAGAAATGGAGTGAGGATGG + Intronic
1012053057 6:94368202-94368224 AGGAAGAAATGGCCTGAGGATGG - Intergenic
1014111405 6:117622091-117622113 AACTAAATATGGCCTGAGAAGGG + Intergenic
1015872478 6:137790973-137790995 CAGAAGACATGGCCTGAGCTTGG + Intergenic
1018143094 6:160859345-160859367 AAGTAAATATGGCCTGAGAAGGG - Intergenic
1018148842 6:160919995-160920017 CATAAGATATTGCCTGGGGAAGG + Intergenic
1018225533 6:161625364-161625386 GAGAACATATGGACAGAGGAAGG + Intronic
1018816004 6:167331624-167331646 AAGTAAATATGGCCAGAGAAGGG + Intronic
1018856641 6:167679704-167679726 AAGAAGAGACTGCTTGAGGATGG + Intergenic
1019773255 7:2896911-2896933 AGGTAGGTATGACCTGAGGAAGG + Intergenic
1020413090 7:7915019-7915041 TAGAAGATAGGGCATGGGGAAGG + Intronic
1022118620 7:27285257-27285279 GGGAAGATATGGCTTCAGGAGGG - Intergenic
1022832035 7:34077284-34077306 GAGAAGATATGGAGTTAGGAAGG + Intronic
1024773930 7:52759910-52759932 AAGAAGAAATGGAAGGAGGAGGG + Intergenic
1027219370 7:76204214-76204236 AATAAAATATGGGCAGAGGAGGG - Intronic
1030283737 7:107803690-107803712 ATGCAGATATGGCCTGTGGCTGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031951557 7:127897957-127897979 GAGAGGATAGGGCCTCAGGAAGG - Intronic
1032224775 7:130022513-130022535 GGGAAGATGTGTCCTGAGGAAGG + Exonic
1033619860 7:143052423-143052445 GAGAAGATAAAGCATGAGGAAGG - Exonic
1034528772 7:151682802-151682824 AAGAGGAGAGGGCCTGAGGGTGG + Intronic
1034697822 7:153069625-153069647 AAGAAGGAATGGCCTTAGGTGGG + Intergenic
1035464941 7:159068713-159068735 AAGAAGGCAGGGTCTGAGGAGGG + Intronic
1035648107 8:1243803-1243825 AAGTAAATGTGGACTGAGGAAGG - Intergenic
1037918556 8:22787879-22787901 AAGAAGATCTGGGCAGATGAAGG + Intronic
1038239617 8:25796619-25796641 AAGAAGATATGGGCCGGGCACGG + Intergenic
1038293966 8:26274039-26274061 AAGAAGAGGTGGCAGGAGGAAGG - Intergenic
1039080767 8:33732087-33732109 AAGTAGAAATTGACTGAGGAAGG + Intergenic
1039416770 8:37401907-37401929 AAGTAGATATGGCATGAGGAGGG - Intergenic
1040001884 8:42583850-42583872 AAGAAAATTAGGCCTGAGGCTGG - Intergenic
1041899762 8:62968722-62968744 TAGAAGGCACGGCCTGAGGAAGG - Intronic
1044107846 8:88234437-88234459 AAAAAGATTTGGCCTTAGAATGG + Intronic
1045070370 8:98498199-98498221 ATGAAGATCTGGGCTGAGGCAGG + Intronic
1045771622 8:105747571-105747593 TAAAAAATATGGCCAGAGGATGG - Intronic
1046532584 8:115467269-115467291 AAGCAGCTCTGGCCTGTGGAAGG + Intronic
1046585241 8:116142486-116142508 AGCCAGATGTGGCCTGAGGAGGG - Intergenic
1046959390 8:120094235-120094257 CAGAATAGATGGGCTGAGGATGG + Intronic
1047743401 8:127825738-127825760 AAGAAGGTATGTACTGAGCAAGG - Intergenic
1050724890 9:8637781-8637803 AATAAAATATGGCATGAAGATGG + Intronic
1053614390 9:39748304-39748326 AAGACAATATGGCTTGAGTATGG - Intergenic
1053872419 9:42506244-42506266 AAGACAATATGGCTTGAGTATGG - Intergenic
1054553258 9:66628610-66628632 AAGACAATATGGCTTGAGTATGG + Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055675659 9:78657732-78657754 AAGAAGAAATGTCCTGAGAAGGG - Intergenic
1058346557 9:103970335-103970357 ATGAAGATATTGCCTGAGACTGG - Intergenic
1058527412 9:105873798-105873820 TGGATGATATGGCCTGAGGTGGG + Intergenic
1058921374 9:109618581-109618603 AAGAAGAAATACCATGAGGATGG - Intergenic
1059139144 9:111835583-111835605 AAAAAGATATGGACAGATGAAGG - Intergenic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059742433 9:117165003-117165025 AAGAAGATATGGCTGGTGTAGGG + Intronic
1060010695 9:120040752-120040774 CTGAAGATATGCCCTCAGGATGG + Intergenic
1060983112 9:127804668-127804690 CCGAAGCTATGGCCTGAAGACGG + Exonic
1187066142 X:15839776-15839798 AAGAATATTTGGGCTGAGCACGG - Intronic
1187447614 X:19372950-19372972 AAGATGAAATTGCCGGAGGAAGG + Intronic
1187679644 X:21754400-21754422 AAGAATATATGGCCAGTGAAAGG - Intronic
1189718585 X:43891013-43891035 AAAAAAATGTAGCCTGAGGAGGG - Intergenic
1189990319 X:46587929-46587951 CAGAACAAATGGGCTGAGGAAGG - Intronic
1191084909 X:56555268-56555290 AACTAAATATGGCCTGAGAAGGG + Intergenic
1192220992 X:69197219-69197241 AAGTAGTTAAGGCCTGAGGCAGG - Intergenic
1193906306 X:87249162-87249184 AACTAAATATGGCCTGAGAAGGG - Intergenic
1195589500 X:106608187-106608209 AACAAGAGAGGGCCTGAGGGTGG - Intergenic
1196561925 X:117159920-117159942 AAGAAGATATGGGCCGGGCATGG + Intergenic
1196600671 X:117598411-117598433 AAGAAAATATGGCCACAGGGAGG + Intergenic
1197313691 X:124937522-124937544 AAGAAGATACTCCCTGAGAAAGG + Intronic
1197582307 X:128298898-128298920 AAGAAGATTTGGCATAAGAATGG + Intergenic
1198702336 X:139411345-139411367 AAAAAGATATTCCATGAGGACGG - Intergenic
1199169317 X:144717698-144717720 CAGAACATAGGGCTTGAGGAAGG + Intergenic
1199228490 X:145408154-145408176 AATAACATATTGTCTGAGGAAGG + Intergenic
1201423619 Y:13825820-13825842 AAGAAGACATGGCAGGAGGTAGG + Intergenic
1201483688 Y:14469295-14469317 AAGAAGACAAGGCATGATGAGGG + Intergenic
1201679570 Y:16629067-16629089 TAGAAAAGTTGGCCTGAGGAGGG - Intergenic
1201740886 Y:17323891-17323913 GAGAACATATGGACAGAGGAAGG + Intergenic