ID: 1124868897

View in Genome Browser
Species Human (GRCh38)
Location 15:33521219-33521241
Sequence GTGCAAAGCAGAATCTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124868893_1124868897 24 Left 1124868893 15:33521172-33521194 CCATCTGAGCCATCTCGCAGATT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG 0: 1
1: 0
2: 2
3: 7
4: 129
1124868894_1124868897 15 Left 1124868894 15:33521181-33521203 CCATCTCGCAGATTATACCTATT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG 0: 1
1: 0
2: 2
3: 7
4: 129
1124868896_1124868897 -8 Left 1124868896 15:33521204-33521226 CCATGTGCTAAACTTGTGCAAAG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG 0: 1
1: 0
2: 2
3: 7
4: 129
1124868895_1124868897 -2 Left 1124868895 15:33521198-33521220 CCTATTCCATGTGCTAAACTTGT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG 0: 1
1: 0
2: 2
3: 7
4: 129
1124868892_1124868897 25 Left 1124868892 15:33521171-33521193 CCCATCTGAGCCATCTCGCAGAT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG 0: 1
1: 0
2: 2
3: 7
4: 129
1124868891_1124868897 29 Left 1124868891 15:33521167-33521189 CCAACCCATCTGAGCCATCTCGC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG 0: 1
1: 0
2: 2
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124868897 Original CRISPR GTGCAAAGCAGAATCTAAGT TGG Intronic
907518832 1:55010192-55010214 GTGCAGAGCAGAAGCTGAGGTGG + Exonic
909380836 1:74996632-74996654 TTGCAGAGCAGGATCTAGGTAGG + Intergenic
909512317 1:76468258-76468280 TTGCTAATCAGTATCTAAGTGGG - Intronic
910545477 1:88411382-88411404 GTTCAAAACCTAATCTAAGTAGG - Intergenic
911352841 1:96775139-96775161 GTGCATAGCAGTATCTCATTCGG - Intronic
917710868 1:177682784-177682806 GTGCAAAGAAAAATCTGACTTGG - Intergenic
919149700 1:193680102-193680124 TTGCAAAGCAAAATGCAAGTTGG + Intergenic
920232870 1:204482012-204482034 TTAAAAAGCAGAATCTAAGGAGG + Intronic
921536018 1:216350080-216350102 GTGGAAAGCAGGAGCAAAGTGGG + Intronic
922434555 1:225590923-225590945 CTGCAAAGGAGAATCTAGTTAGG + Intronic
1064131001 10:12709426-12709448 TTGCAATGCAGAGTCTAAGGAGG + Intronic
1064954567 10:20893488-20893510 GTGCAAAGCAGAAACTAGGTGGG + Intronic
1071668966 10:87589393-87589415 GTGCAAAGCTGACTCTGAGATGG + Intergenic
1074429079 10:113377985-113378007 GAGCAAAGGAGAATCAAAGCTGG + Intergenic
1078000885 11:7494666-7494688 GTGCAGAGCAGAATGGCAGTAGG + Intronic
1080607868 11:33878775-33878797 TTGCAAGGCAGAATCTAATGAGG - Intronic
1086477515 11:87193237-87193259 GTGTCTAGCAGATTCTAAGTGGG + Intronic
1087728555 11:101752316-101752338 TTGAAAAACAGAATCTTAGTAGG + Intronic
1088941324 11:114460045-114460067 CTGTAAAGCAGCATCTCAGTTGG + Intergenic
1091807567 12:3366783-3366805 GTGCAAAGCTGTCCCTAAGTGGG + Intergenic
1092767293 12:11864067-11864089 GTCCAAAGTAAAATCTGAGTTGG + Intronic
1093558189 12:20504001-20504023 GTTCATATCAGAATCTAAGGAGG + Intronic
1096861539 12:54532261-54532283 GTGCAAAGTAGAATCTAATTAGG + Intronic
1097555430 12:61131692-61131714 ATCCCAAGCAGAATCTAAATGGG + Intergenic
1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG + Intergenic
1103383547 12:120513862-120513884 ATGAAAAGTAGAAACTAAGTAGG - Intronic
1107984429 13:45763245-45763267 GTGGAAAGTAGAGTCAAAGTGGG + Intergenic
1108598048 13:51966698-51966720 GTGCAGAGCAGGGTCTACGTCGG - Intronic
1109649615 13:65309417-65309439 GCACAAAGCAGAATCTTAGAGGG - Intergenic
1110588340 13:77222184-77222206 TTGCAAAGCAAAATATCAGTTGG + Intronic
1113405375 13:110033978-110034000 ATGCAATCCAGCATCTAAGTAGG + Intergenic
1117079089 14:52133008-52133030 GTGCAAAGATGAATGTATGTTGG + Intergenic
1120340872 14:83219725-83219747 GTACAAAGCAGAAAATAACTTGG + Intergenic
1120823594 14:88935289-88935311 GTGCTATGGAGAACCTAAGTTGG + Intergenic
1121420184 14:93807744-93807766 GTGCCCAGGAGAATCTAACTTGG + Intergenic
1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG + Intronic
1125888329 15:43246294-43246316 GTCCAAATCAGGATCTAATTAGG - Intronic
1129882847 15:79018549-79018571 GAGCAAAGCAGAACCAAAGCAGG - Intronic
1130096838 15:80862392-80862414 GTGCCATGCAGACTCAAAGTCGG + Intronic
1130429717 15:83834440-83834462 CTGCAAATCAGAATCTAACTTGG - Intronic
1132006860 15:98235172-98235194 GTGCAGAGCAACATCCAAGTAGG + Intergenic
1138719701 16:59065313-59065335 ATGCAAAGGTGAATCTAAGGTGG - Intergenic
1139155801 16:64440609-64440631 GTGCAAATCACAGTCTAAGATGG - Intergenic
1145095760 17:20024686-20024708 GTGCAAAGCAGAAAACAAGGGGG - Intronic
1148066683 17:44876152-44876174 GTTCAAAGCAGAACCAAAGAAGG + Intronic
1148256358 17:46136060-46136082 GTGCATATCAGAATTTATGTGGG - Intronic
1148973725 17:51508262-51508284 GTGCCAAGTACAGTCTAAGTAGG - Intergenic
1149248227 17:54736960-54736982 GTGCTAAGCTAAATCTAACTGGG + Intergenic
1153423949 18:4942127-4942149 GTCAAAGTCAGAATCTAAGTTGG - Intergenic
1154513989 18:15140964-15140986 GAGCAAAGAAGATTATAAGTAGG + Intergenic
1161396961 19:4049765-4049787 GTGCAAAGCACAAGCTACGCTGG + Intronic
1165789114 19:38480694-38480716 GTTTGAATCAGAATCTAAGTAGG + Intronic
927341139 2:21983965-21983987 CTACAAACCAGAATCTCAGTTGG + Intergenic
928317968 2:30260433-30260455 GTGCAAGGCAGGATCAAACTGGG + Intronic
928619170 2:33071486-33071508 GTGCAAGGCAGCCTCTAAGATGG - Intronic
931394061 2:61870381-61870403 GTGCAATGAAGAATTTAAGGTGG - Intronic
933750183 2:85598301-85598323 GTTCAAACCAGACTCTGAGTGGG + Intergenic
936648702 2:114401930-114401952 TTACAAAGCAGATTCCAAGTGGG - Intergenic
937591280 2:123615568-123615590 GTGCAAAGGGGAATGAAAGTGGG + Intergenic
937822988 2:126333233-126333255 GTGCAATGCTGAATGGAAGTGGG - Intergenic
938678884 2:133668489-133668511 GTGCAAAGTGGTATCTAATTTGG + Intergenic
939048149 2:137274216-137274238 GGGGAAAGCAAAATCTAAATTGG - Intronic
948236859 2:236397667-236397689 ATGCAAAGCAGAGTCTTAGATGG + Intronic
948248945 2:236509576-236509598 GTGCAATACAGAAAATAAGTTGG + Intergenic
1169798235 20:9488454-9488476 GTGCAAAGCAAAATGGAAATGGG + Intergenic
1171094415 20:22317629-22317651 TTATAAAGCACAATCTAAGTCGG + Intergenic
1173158742 20:40636953-40636975 GGGCAAAGCAGAATGTGAGCTGG - Intergenic
1173336774 20:42118538-42118560 GTGCAAAGCAGCAGCTGAGAAGG + Intronic
1174517497 20:51103819-51103841 GAGCAAAGCAGGATACAAGTTGG - Intergenic
1177234592 21:18371408-18371430 CTAGAAAGCAGCATCTAAGTAGG - Intronic
1178747501 21:35267221-35267243 GTGCAAAACAGAATTTGAATGGG - Intronic
1182406131 22:30132706-30132728 GTGCAAAGAGGAATGAAAGTTGG + Intronic
1182999335 22:34842156-34842178 GTCCAAAGCAGAACCTAATAAGG + Intergenic
1183264260 22:36815938-36815960 GTGCAAAGCAGAAAGGAAATGGG + Intronic
1183781766 22:40003428-40003450 GTGCAAAGCAGAGCCTATTTGGG + Intronic
949843251 3:8343097-8343119 GTTAAAAGCTGAATCTAAGAAGG - Intergenic
949996811 3:9624044-9624066 GTTCAAATCAGAATTTAAATAGG + Intergenic
954347558 3:50013041-50013063 GTGCTAAGAAGAATCTGGGTGGG - Intronic
955665726 3:61347451-61347473 GTGCAAACCAGTCTCTGAGTTGG - Intergenic
962359649 3:134727064-134727086 GTGGCAATCAGAATCTAAGCAGG - Intronic
966765314 3:183456506-183456528 GTGCCAAGCAGCAGCTAACTTGG - Intergenic
969068994 4:4516865-4516887 GTGAAAAACAGTATCTAACTTGG + Intronic
969684640 4:8664329-8664351 GAGCAAAGCAGAAAAGAAGTTGG + Intergenic
970185998 4:13454734-13454756 CTGCAAACCAGACCCTAAGTTGG - Intronic
971069094 4:23070377-23070399 GTGCAAAGCAGATTCTACAAAGG - Intergenic
974931516 4:68365905-68365927 GTGCAAATCAGAAACTCAATAGG - Intergenic
976439081 4:85053521-85053543 ATGAAAAGAAGAATCTAAGTTGG - Intergenic
978697384 4:111598210-111598232 CTGCTAAGCAGAAGCTAATTAGG - Intergenic
985832203 5:2242144-2242166 CTGCAAAGCAGATTCTAGGCTGG - Intergenic
986149948 5:5119524-5119546 GTGGAATTCAGAATCTAAGTGGG - Intergenic
986836861 5:11648473-11648495 GTGTAAAGCTGAACCCAAGTGGG - Intronic
989543334 5:42643242-42643264 ATGCAAAGCTGAAGCTAAATAGG + Intronic
989628349 5:43455070-43455092 TTGAAAAACAGAAACTAAGTTGG + Intronic
990653699 5:57931046-57931068 GGGCAAAGCACAGTCTAATTGGG + Intergenic
992174689 5:74138411-74138433 GCGGAAAGCAGATTCTAGGTTGG + Intergenic
994333119 5:98531287-98531309 GTTCATAGCAGAATCTAATTAGG - Intergenic
995874549 5:116776976-116776998 ATGCCAAGAAGAATCTAAATAGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999560849 5:152800671-152800693 GTGCAAAGAGGAAAGTAAGTAGG - Intergenic
1000382709 5:160643556-160643578 TTGGAAAGCAGGATCAAAGTGGG + Intronic
1000454451 5:161432450-161432472 GTGCAAAGGACAATCAAATTAGG + Intronic
1002776302 6:330390-330412 GTGCAAAGCAGAATGTCAGCTGG + Intronic
1004680006 6:17884260-17884282 GTGCCAAGCATTATCTTAGTAGG - Intronic
1009272046 6:61625777-61625799 GTGAAAAGCAGATTCCAAGACGG - Intergenic
1009345406 6:62608549-62608571 GTGCAGAGTAGAAACTAACTAGG - Intergenic
1012550196 6:100458379-100458401 GCGCCAAGTAGAACCTAAGTGGG - Intronic
1012685908 6:102248330-102248352 ATGAAAAGCAGTATCTTAGTTGG + Intergenic
1012901731 6:105014076-105014098 GTGCAAAGGAAACTCAAAGTTGG - Intronic
1013872644 6:114785356-114785378 GTGCAAAGCAGATTCCAATTTGG - Intergenic
1016542041 6:145177563-145177585 ATGGAAACCAGAAGCTAAGTAGG + Intergenic
1018288110 6:162262885-162262907 GGGCAAAGGAGCACCTAAGTTGG - Intronic
1022193322 7:28038946-28038968 GAACAAAGCAGAATGTAAGCAGG + Intronic
1024215582 7:47245684-47245706 GTGCAAAGCAGAATGTGTGGGGG + Intergenic
1025958743 7:66202665-66202687 GTAGAAAGCAGAATGTAACTTGG + Intergenic
1028655960 7:93207373-93207395 GTGCAAAGGAGAGTCTGAGAAGG + Intronic
1033167848 7:139056814-139056836 TTGCAAATCAGTATCTAAGCAGG - Intronic
1037130742 8:15405322-15405344 TTGCAAAGCAGAATACAAATGGG - Intergenic
1038379165 8:27076019-27076041 CTACAAAGGAGAATTTAAGTTGG + Intergenic
1039517164 8:38143841-38143863 GCACAAAGCAGAATCTCAGAGGG - Exonic
1043924018 8:86016370-86016392 GAGAAAAGCAAAATTTAAGTAGG + Intronic
1044520753 8:93196518-93196540 GTAGCAAGCAGAATGTAAGTTGG - Intergenic
1047153419 8:122290953-122290975 GTGCCAATCAGAAGCTGAGTCGG - Intergenic
1047830478 8:128623921-128623943 TTGGAAAGCAGAATCTTGGTAGG - Intergenic
1047951371 8:129939017-129939039 GGACAACGCAGTATCTAAGTTGG + Intronic
1048946578 8:139454014-139454036 GTGGGAAGCAGAATGTAGGTGGG - Intergenic
1052275556 9:26671886-26671908 GTGCAAAGCAGAACTTAATGGGG + Intergenic
1053671629 9:40370822-40370844 AAACAAAGCAGAATCAAAGTTGG + Intergenic
1053921439 9:42997191-42997213 AAACAAAGCAGAATCAAAGTTGG + Intergenic
1054382744 9:64510866-64510888 AAACAAAGCAGAATCAAAGTTGG + Intergenic
1054512989 9:66005488-66005510 AAACAAAGCAGAATCAAAGTTGG - Intergenic
1056616791 9:88175271-88175293 TTGAAAAGAAGAATCTTAGTTGG - Intergenic
1056900017 9:90589668-90589690 GTGCAAAGCAGAATGAAGGAAGG + Intergenic
1058399393 9:104596246-104596268 GTTCCAGGCAGAATGTAAGTTGG - Intergenic
1058748476 9:108015616-108015638 GTGCAAAACAGAAACTAACTGGG - Intergenic
1189042081 X:37553543-37553565 GAGCAAAGCAGAGTCTTATTGGG + Intronic
1189106934 X:38246170-38246192 GTCCAAATCAAAATCTCAGTAGG + Intronic
1190166785 X:48079646-48079668 ATGCAAAGCAGAATCTAGACTGG - Intergenic
1192920038 X:75696745-75696767 GTGCACAGAAGAATTGAAGTTGG - Intergenic
1193398684 X:81015957-81015979 GTGCAAAGCAGGTACTCAGTGGG + Intergenic