ID: 1124870746

View in Genome Browser
Species Human (GRCh38)
Location 15:33539605-33539627
Sequence GGTTAGGGATGCTGACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124870743_1124870746 -7 Left 1124870743 15:33539589-33539611 CCTTAAACAATGTAGGGGTTAGG 0: 1
1: 10
2: 78
3: 247
4: 527
Right 1124870746 15:33539605-33539627 GGTTAGGGATGCTGACCCCCTGG 0: 1
1: 0
2: 3
3: 16
4: 130
1124870742_1124870746 -6 Left 1124870742 15:33539588-33539610 CCCTTAAACAATGTAGGGGTTAG 0: 1
1: 10
2: 83
3: 273
4: 571
Right 1124870746 15:33539605-33539627 GGTTAGGGATGCTGACCCCCTGG 0: 1
1: 0
2: 3
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124870746 Original CRISPR GGTTAGGGATGCTGACCCCC TGG Intronic
905394006 1:37655757-37655779 GGTTAGGGAATCTGAGCCCCAGG - Intergenic
907374381 1:54023789-54023811 GGTTAGAGATGCAGATTCCCAGG + Intergenic
907731635 1:57072267-57072289 GGATAGGGATACTCACCGCCTGG + Exonic
910243905 1:85118800-85118822 GGTTGGGGAAGGTGACCCACAGG + Intronic
915445073 1:155969874-155969896 GGTCTGGGATCCTGACCCCTGGG - Intronic
915731690 1:158058567-158058589 GGTTAGGAATTCTGACACCTAGG + Intronic
917272708 1:173296215-173296237 GGTTAGAAATCCTGACCCCTTGG + Intergenic
920843642 1:209575727-209575749 GGTTTGGGAGGGTGACACCCAGG - Intergenic
921724187 1:218506371-218506393 TGTTAAGGATAATGACCCCCAGG + Intergenic
922459417 1:225803423-225803445 TGTTAGGCAGGCTGACCACCTGG - Intergenic
922581066 1:226698345-226698367 GGCTAGGGATGCTGACTGCTAGG + Intronic
922765265 1:228153074-228153096 GGGGAGGGGTGCTGGCCCCCAGG - Intronic
1067250479 10:44582255-44582277 GGGTGTGGATGCTGACCTCCGGG - Intergenic
1067542928 10:47169335-47169357 GGTTAGGGGTACAAACCCCCAGG - Intergenic
1069726708 10:70584833-70584855 GGGTACGGATCCAGACCCCCAGG - Intergenic
1069934516 10:71906065-71906087 GGGTGGGGAAGCTGACCTCCAGG + Intergenic
1070988294 10:80707642-80707664 GGTGAGGGAGGCTGAGTCCCTGG + Intergenic
1073512501 10:104051597-104051619 GGTTAGGGACGCTGTCTTCCAGG + Intronic
1075833673 10:125433902-125433924 GCTTAGGGGTGCTGACCCCCAGG - Intergenic
1076869594 10:133186850-133186872 GGCTGGGGATGCTGTCACCCAGG + Intronic
1077330244 11:1980982-1981004 GGGTAGGGCTGCTGGGCCCCCGG + Intronic
1077462695 11:2718478-2718500 GGACAGGGATGATGAACCCCAGG + Intronic
1080221536 11:29911127-29911149 GGTTAGGGGTGCCAACCCCCTGG - Intergenic
1081975173 11:47229297-47229319 GGTTGAGGATGCTGAACCACAGG + Intronic
1083431100 11:62613821-62613843 GGTAACGGCTGCTGACCCACTGG - Exonic
1083998802 11:66284982-66285004 GGAAAGGGTTGGTGACCCCCAGG + Intronic
1084304062 11:68270335-68270357 GGATAGGGAGGTTGACACCCAGG - Intronic
1085348167 11:75781401-75781423 GGCCATGGATGCTGAACCCCGGG - Intronic
1086132991 11:83420270-83420292 GGTGGGGGATGCTTGCCCCCAGG - Intergenic
1086393497 11:86390189-86390211 AGTTAGGCATGCTGTCCTCCGGG - Intronic
1088543996 11:110941631-110941653 GGTTAGGAGTGCCAACCCCCAGG + Intergenic
1088606955 11:111541362-111541384 GGGTAGGGATGCTGGATCCCCGG + Intronic
1089462676 11:118662161-118662183 GGTGAGGGATGAGGACCCCAAGG - Intronic
1202813223 11_KI270721v1_random:36161-36183 GGGTAGGGCTGCTGGGCCCCCGG + Intergenic
1092953892 12:13531852-13531874 GGTTAGGCAGGCTGTCCCCCAGG - Intergenic
1099913204 12:88859401-88859423 GGTTAGGAGTGCAGACCCCGAGG - Intergenic
1102490471 12:113287233-113287255 GGGTGGGGATGTTGACCCCATGG - Intronic
1102634719 12:114312811-114312833 GGTTAGAGATGCTGAATCCCAGG - Intergenic
1103179802 12:118900348-118900370 GGCTAGGGATGCTTATCCCCAGG + Intergenic
1104092578 12:125528022-125528044 GGAGAGGGATGCTGCCACCCAGG + Intronic
1104978518 12:132562615-132562637 GGGAAGGGATGCTGAGCTCCTGG - Intronic
1106565214 13:30878726-30878748 GGTTAGGGTTGCTAACCCGATGG + Intergenic
1110881336 13:80576358-80576380 GGTTAGGGATGCCAACCATCTGG + Intergenic
1113433771 13:110272897-110272919 GATAAGGGATGCTGGACCCCAGG + Intronic
1120260037 14:82172144-82172166 GGTTAGGGATGTTGATCCTGGGG - Intergenic
1124120979 15:26888473-26888495 GGTTAGGGGAGCTGAACCCAGGG + Intronic
1124870746 15:33539605-33539627 GGTTAGGGATGCTGACCCCCTGG + Intronic
1127468036 15:59264116-59264138 GGTTAGGGATGCTGAACTGGTGG - Intronic
1128074232 15:64816415-64816437 GGAAAGAGATGCTGGCCCCCAGG - Intronic
1129271443 15:74421339-74421361 GGTGAGGGCTGCTGGCCCCTGGG + Intronic
1133231465 16:4369045-4369067 GGTGAGGGAGGCTGAGCACCAGG - Intronic
1134829416 16:17311245-17311267 GGTTAGAAATGCAGACTCCCAGG + Intronic
1135525645 16:23211935-23211957 GTTAAGGGAGGCTGACCCCCTGG + Intronic
1136537274 16:30907428-30907450 GGAGAGGGATGCTGCCTCCCAGG - Intergenic
1137435091 16:48448306-48448328 TGTTTGGGATGCTGCCTCCCTGG - Intronic
1137614187 16:49837195-49837217 GGACAGGGACCCTGACCCCCAGG - Intronic
1137937404 16:52647631-52647653 TCTTAGGGATGCTTACCCCCAGG - Intergenic
1141459983 16:84172513-84172535 GGTTAGAAATGCAGACTCCCAGG + Intronic
1142502087 17:338917-338939 GGTGTGGGACGCTGCCCCCCGGG - Intronic
1143099935 17:4499306-4499328 GGTTTGGGCTGCTGAGCGCCGGG - Exonic
1143526517 17:7476175-7476197 GGTTAGGGACGTTGACCCTCAGG - Intronic
1144854895 17:18262289-18262311 GGGTAGTGATGATGACACCCTGG + Intronic
1149259098 17:54859470-54859492 GGTTAGGAGTACTGATCCCCTGG + Intergenic
1149560142 17:57602836-57602858 GGTTAGGAATGCAGAGTCCCAGG + Intronic
1151417552 17:73976335-73976357 GGCTAGGGCTCCTGACTCCCAGG - Intergenic
1152019677 17:77774142-77774164 GGTTGGGCATGATAACCCCCAGG + Intergenic
1152265417 17:79291500-79291522 GGTCAGGGATGCTCCTCCCCTGG + Intronic
1155106608 18:22673132-22673154 GGCTAGGGATACTGACTCCCTGG - Intergenic
1156449602 18:37259423-37259445 AGGCAGGGATGCTGAGCCCCGGG + Intronic
1157313557 18:46570383-46570405 GGTGAGTGATGCTCACTCCCAGG + Intronic
1157690361 18:49677011-49677033 GGCAAGGGATGCTGACATCCTGG + Intergenic
1160905074 19:1448096-1448118 GGTTGGGGATGCAGAGCCCAGGG - Intronic
1165169794 19:33883950-33883972 GGGCAGGGATGCTGAGCCCAGGG + Intergenic
1165999540 19:39870254-39870276 GGACAGGGATGCAGACACCCTGG + Exonic
1166046973 19:40235525-40235547 GGTCCGGGTTGCTGACTCCCTGG - Intronic
1166321575 19:42022252-42022274 GGTAGAGGATGCTGATCCCCAGG + Exonic
1166621751 19:44307212-44307234 GGTTAGGGGAGCTGACCCCTGGG + Intergenic
1167333224 19:48868954-48868976 GGTTAGGGATCCAGACTCCTGGG + Intergenic
1168026539 19:53647765-53647787 GGTTAGGGATGTGGAGACCCTGG - Intergenic
924981340 2:224523-224545 GGACAGGGCTGCTGAGCCCCGGG - Intronic
925977393 2:9150728-9150750 GCTTAGGGCTGCTGGCCCCTCGG + Intergenic
926441202 2:12890435-12890457 GGTTGGGGAGCCTGACCCTCAGG + Intergenic
928179494 2:29058013-29058035 ATTTAGGGATGCTGACTCCCAGG - Exonic
931467742 2:62506131-62506153 GGTGAGGGATACTGAGGCCCAGG - Exonic
932705583 2:74021693-74021715 GGTTATGGATGCAGATTCCCAGG - Intronic
933762499 2:85681982-85682004 GGTGAGGTCTGCTGACTCCCTGG + Intergenic
935679054 2:105620336-105620358 GGGTAGGGATGCACCCCCCCAGG - Intergenic
937888082 2:126914155-126914177 TGTCAGGGATGCTGTCCCCAGGG - Intergenic
938948605 2:136236867-136236889 AGGAAGGGATGCTGACCCCAAGG - Intergenic
941461980 2:165782592-165782614 GGCTAGATCTGCTGACCCCCTGG + Intronic
943665094 2:190600909-190600931 GGGCAGGGATGCTGGCCGCCAGG - Intergenic
948753003 2:240143325-240143347 GGTTAGGGATGCAGAATCCCAGG - Intronic
948896793 2:240931391-240931413 AGTTCTGGGTGCTGACCCCCAGG - Intronic
948993279 2:241565168-241565190 GGTGGGGGATGCTGACCACAGGG - Intronic
1170572163 20:17638485-17638507 GCCTTGGGACGCTGACCCCCAGG - Intronic
1172865016 20:38089155-38089177 GGTTAGGCCTCCTGACCCCTAGG - Intronic
1174140226 20:48407833-48407855 GGCTCAGGATGCTGACCCGCTGG + Intergenic
1175290071 20:57869758-57869780 GGGTGGAGACGCTGACCCCCAGG - Intergenic
1175293896 20:57895756-57895778 GGGTGGAGATGCTGACCCCCAGG - Intergenic
1179528807 21:42003660-42003682 GATTAGGGACGCTGAACCACTGG + Intronic
1183359167 22:37374583-37374605 GGTGTGGGATGATGACCACCAGG + Exonic
1184659616 22:45959898-45959920 GGTCTGGGATGCTGAGGCCCGGG - Intronic
949545871 3:5071887-5071909 GGTTGGGGGTGGTAACCCCCAGG + Intergenic
955552439 3:60098881-60098903 GGTTAGGGGTGCTGACTCCCAGG - Intronic
957979910 3:87495350-87495372 GGTTAGCTGTGCTGACTCCCTGG + Intergenic
959078837 3:101779270-101779292 GGCCAGGGATCCTGACGCCCCGG - Intronic
964627455 3:158772893-158772915 GGTGAGAAATGCTGACCCCAAGG - Intronic
964983479 3:162713553-162713575 GGTGGGGGATGCTTGCCCCCAGG - Intergenic
965862142 3:173160460-173160482 GGTTGGGGGTGCTTGCCCCCAGG + Intergenic
966853138 3:184176685-184176707 GGTTACTGATGCTCAGCCCCAGG + Intronic
969662411 4:8537972-8537994 GGCTAATGATGCTGACACCCAGG - Intergenic
973588366 4:52414554-52414576 GGTTAGGGATGCTGAATGCCTGG - Intergenic
974384266 4:61184400-61184422 GCTTTGGGATGGAGACCCCCTGG - Intergenic
976590870 4:86848776-86848798 TGTTAGAGATGGTGCCCCCCGGG + Exonic
978273281 4:106917179-106917201 CGTAAGAAATGCTGACCCCCAGG + Intergenic
981774857 4:148354422-148354444 GGTTAGGGACACTGACAACCCGG - Intronic
984390454 4:179124508-179124530 GGTTAGGTATTCTTACTCCCAGG - Intergenic
996518573 5:124401020-124401042 GGTTAGGAATGCTGACTCTGGGG - Intergenic
997124945 5:131216691-131216713 GGTTAGGGATGTTTGCACCCAGG - Intergenic
999705960 5:154272564-154272586 GGTGAGTGGCGCTGACCCCCAGG - Intronic
1005860603 6:29897011-29897033 CGTGAGGGGTCCTGACCCCCAGG - Intergenic
1005905981 6:30261547-30261569 GGTGAGGGGTTCTGACCCCCAGG - Intergenic
1006738896 6:36293568-36293590 GGTTAGGGGCGCAGACCCTCAGG - Intronic
1007043997 6:38753012-38753034 GGGTATGGATGCTGTCACCCAGG + Intronic
1007716241 6:43857775-43857797 GGTAAGGGATGCCGAGGCCCAGG + Intergenic
1008498503 6:52156513-52156535 GGTTAGGGAGGTTGAAGCCCAGG - Intergenic
1009056808 6:58346206-58346228 GGTTAGGGGGACTGACCTCCCGG - Intergenic
1009234435 6:61105366-61105388 GGTTAGGGGGACTGACCTCCCGG + Intergenic
1019356495 7:582639-582661 GGCGAGGGCTGGTGACCCCCCGG - Intronic
1020152428 7:5693373-5693395 CAGTATGGATGCTGACCCCCCGG + Intronic
1021603692 7:22389895-22389917 GGTTAGAGATGCAGAATCCCAGG - Intergenic
1021774514 7:24039279-24039301 GGTGAGGGAGGCTGACTGCCAGG + Intergenic
1024512064 7:50212271-50212293 GCTTAGGGAAGCTGAGACCCGGG + Intergenic
1029573385 7:101386551-101386573 GGACAGGGCTCCTGACCCCCAGG - Intronic
1029982008 7:104887531-104887553 GGTAAGGGATGGTGATTCCCTGG + Intronic
1032095874 7:128938313-128938335 GGTTTGGGGTGCTGGCGCCCGGG + Intronic
1032669447 7:134069714-134069736 GCTTTGGGAGGCTGAGCCCCAGG - Intergenic
1032783429 7:135182593-135182615 GGTTAGGGTCACTGACCTCCAGG + Intergenic
1038253740 8:25930809-25930831 AGTTAGGGATGCCAACCTCCAGG + Intronic
1038749357 8:30281627-30281649 GATTAGAAATGCTGACTCCCAGG - Intergenic
1040423060 8:47259109-47259131 GTTTAGGGAAGCTGGCCACCAGG + Intergenic
1041779247 8:61559380-61559402 GGTTAGGGATGCTAACCTCCTGG - Intronic
1043870919 8:85431477-85431499 GGTTAGGGATTCTGAGTCACAGG + Intronic
1049164176 8:141116450-141116472 GGCTTAGGATGCTGAGCCCCAGG + Intergenic
1055822898 9:80289083-80289105 GGGAAGAGATGCTGACCACCTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060471623 9:123952653-123952675 AGTCAGGGATCCTGACCCCCTGG - Intergenic
1190165605 X:48070977-48070999 GGTGAGGGATGCTGATCCGTGGG - Intronic
1195816464 X:108894269-108894291 GGCTAGGCATGCTGAACCCTGGG - Intergenic
1199143482 X:144337106-144337128 GGTTTGGAATGCTGTCCCTCAGG - Intergenic