ID: 1124870967

View in Genome Browser
Species Human (GRCh38)
Location 15:33542147-33542169
Sequence GGTTTCTCACCAGTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124870967 Original CRISPR GGTTTCTCACCAGTGGATGC TGG (reversed) Intronic
900733587 1:4280099-4280121 AATTTCTCACCAGGGAATGCAGG - Intergenic
901869516 1:12129636-12129658 GTTTTCTCCCGAGTGGATTCAGG + Intronic
903778860 1:25809296-25809318 GTTTTCTCACCTGTGGATCCGGG + Intronic
908373904 1:63513733-63513755 AGTTTCTCACCTTTGGATGGAGG - Intronic
910984091 1:92988191-92988213 GATTTATCATCAATGGATGCTGG + Intergenic
911068693 1:93814686-93814708 GCTGTAACACCAGTGGATGCCGG - Intronic
913173641 1:116254712-116254734 CGTCTCTAAGCAGTGGATGCGGG - Intergenic
915396681 1:155590394-155590416 TGTTTCTCACCCTTGGATGATGG - Intergenic
917678749 1:177344763-177344785 GGTTTCTGACACGTGAATGCTGG + Intergenic
918860638 1:189821818-189821840 TGTTTATCTCCAGTTGATGCAGG - Intergenic
919745936 1:201009197-201009219 GCTTTCTCTCCATTGGATGCAGG + Intronic
923724756 1:236496375-236496397 ATTTTGTGACCAGTGGATGCTGG - Intergenic
1063612065 10:7571047-7571069 GGTTTCTCAGCAGTCAATGCAGG - Intronic
1063865544 10:10361544-10361566 GGTTTCTCTCTATTGGATGAAGG + Intergenic
1066746196 10:38605311-38605333 GGTTTGGCACCAGTGGGAGCCGG - Intergenic
1069507873 10:69017801-69017823 GATTTCTCATCAGAGGATCCTGG + Intergenic
1069648179 10:70019968-70019990 GGTCTCTCAGCTGTGGATGCTGG - Intergenic
1070959361 10:80488034-80488056 GGTTTCTCACTGGCGGATGTGGG + Intronic
1072469028 10:95694308-95694330 GGTTTCTCACCGTTGGAATCCGG - Intergenic
1076259629 10:129055140-129055162 GCTTTGTCACCAGTGAGTGCAGG - Intergenic
1077336731 11:2008595-2008617 GGCTTCTCACCAGTCCTTGCTGG - Intergenic
1079633976 11:22712330-22712352 GGTCTCCCAGCTGTGGATGCCGG - Intronic
1083179459 11:60974836-60974858 GTTTTCTCATCAGTGGAAGGGGG + Intronic
1084606121 11:70173051-70173073 ATTTGGTCACCAGTGGATGCTGG - Intronic
1086031498 11:82363044-82363066 TTTTTATCAGCAGTGGATGCTGG - Intergenic
1090695475 11:129237078-129237100 GGTTTCATACCAGGGAATGCAGG - Intronic
1202819715 11_KI270721v1_random:63777-63799 GGCTTCTCACCAGTCCTTGCTGG - Intergenic
1091454875 12:599578-599600 GTTTTCTCACCAGTAAATGGGGG - Intronic
1091838721 12:3604318-3604340 GGGTTCTCAACAGTGGATGCAGG - Intergenic
1092042000 12:5393406-5393428 GGTCTCTTACCACTGGGTGCAGG + Intergenic
1094007091 12:25765918-25765940 GGTTTCTTAGTAGTGGATCCGGG - Intergenic
1094149928 12:27271443-27271465 GGTTCCTCATGAGTGGATGCTGG + Intronic
1094190090 12:27689308-27689330 GGTTCCTTACCAGCAGATGCAGG + Intronic
1095825791 12:46530328-46530350 GCTATCACACCAGTGGCTGCAGG + Intergenic
1097385910 12:58950108-58950130 GGTCTCTCAGCCGTGGATCCTGG + Intergenic
1100685644 12:96983832-96983854 GGTTCCTCATCAGTGGATTTTGG + Intergenic
1103994660 12:124821325-124821347 GGTTTCTCAGCAGAGGCTGCTGG + Intronic
1111594566 13:90395256-90395278 GGTTTCTCCCCAGAGGAGGATGG + Intergenic
1114500625 14:23165708-23165730 GTTTTTCCACCATTGGATGCTGG - Intronic
1118545726 14:66886230-66886252 GGCTTCTCTCCACTGTATGCAGG + Intronic
1120347292 14:83307156-83307178 AGTTTCTCACCAGAGGAAGGAGG - Intergenic
1120347305 14:83307244-83307266 GTTTTCTCACCAGTCGAAGGAGG - Intergenic
1124021744 15:25931661-25931683 GGTTTCTCACCTGGGGGTGACGG + Intergenic
1124870967 15:33542147-33542169 GGTTTCTCACCAGTGGATGCTGG - Intronic
1125622851 15:41079883-41079905 GCTTGCTCACCAGTGCATGAAGG - Exonic
1128421923 15:67500174-67500196 GGTTTCTTTCCATTGGTTGCTGG - Intronic
1129359572 15:75016264-75016286 GATTTCTCAGGAGTGGGTGCTGG + Intronic
1130063447 15:80585898-80585920 GCTTTCTCAGCAGAGGACGCTGG - Intronic
1132415020 15:101613453-101613475 GGTGTCTCACCAGTGACTGCTGG - Intergenic
1133031917 16:3015152-3015174 TGTTTCTCACCCTTGGATGATGG - Exonic
1134035658 16:11029044-11029066 GGTTTTTCACAGTTGGATGCTGG + Intronic
1136736861 16:32474330-32474352 GGTTTGACACCAGTGGGAGCCGG + Intergenic
1139601613 16:67990811-67990833 AGTTTCTCACCAGAAGCTGCAGG + Exonic
1139664215 16:68445375-68445397 AGTTTCTGACCAGTGGAAGGTGG - Intronic
1139802538 16:69535191-69535213 AGTTTTTCACCACTGGCTGCTGG - Intergenic
1140255188 16:73329693-73329715 GCTTTCCCACCAATGCATGCAGG - Intergenic
1140752975 16:78042952-78042974 GGCCTCTGACCACTGGATGCCGG + Intronic
1141750669 16:85955782-85955804 GTTTTCTCACCACTGTTTGCTGG - Intergenic
1203016208 16_KI270728v1_random:355247-355269 GGTTTGACACCAGTGGGAGCCGG - Intergenic
1203034543 16_KI270728v1_random:628405-628427 GGTTTGACACCAGTGGGAGCCGG - Intergenic
1144070570 17:11667826-11667848 ATTTCCTCACCAGTGGATGTAGG - Intronic
1145907366 17:28523900-28523922 GGTTGGTCCCCACTGGATGCTGG + Intronic
1146627694 17:34446692-34446714 GGTTTCACCCCAGGGGAGGCTGG + Intergenic
1149466593 17:56884663-56884685 TGTTTGTGACCAGTGGCTGCAGG - Intergenic
1152249504 17:79204257-79204279 GGATACACACCAGTGGACGCCGG + Intronic
1152766178 17:82140723-82140745 GGTTCCTTACAAGTGGCTGCTGG - Intronic
1155326887 18:24673206-24673228 TGTGTCTCATCAGTGAATGCTGG + Intergenic
1156460053 18:37316546-37316568 GGCTTGTCACCATTGGAAGCAGG - Intronic
1158097705 18:53793114-53793136 GGTCTCTCACCCGTGGATACTGG - Intergenic
1160356685 18:78232988-78233010 GGATTCCCCACAGTGGATGCTGG - Intergenic
1164267382 19:23632614-23632636 GGCTTCTCAGCTGTGGATACAGG - Intronic
1164594319 19:29523963-29523985 GGTTTTTCAGCAGTGGAAGAGGG + Intergenic
1167725505 19:51210409-51210431 GGCTTCACAGCTGTGGATGCTGG - Intergenic
925882899 2:8367889-8367911 GGTTTCTCCCCAGGGCAAGCTGG + Intergenic
926247465 2:11131842-11131864 GGTATCTCCCCACTGGGTGCAGG + Intergenic
927516909 2:23677184-23677206 GGCTGCACACCAGTGGGTGCGGG - Intronic
928084536 2:28337517-28337539 GGTTTCTAATCTGTGGAAGCAGG - Intronic
928193755 2:29197574-29197596 AGTTTGTCACCAGTGGAGGCCGG - Exonic
930356848 2:50331725-50331747 GGTTTCTATTCAGAGGATGCAGG - Intronic
931172347 2:59816584-59816606 TGCTTCTCACCAGTGGCTGCTGG + Intergenic
931839668 2:66135287-66135309 GGTTGCTCATCAGGGGTTGCAGG - Intergenic
933635190 2:84701133-84701155 TTTTTCTCACAAGTCGATGCTGG + Exonic
934853146 2:97713763-97713785 GGTTTCTCACTCATGGATGGGGG - Intronic
934920451 2:98340124-98340146 ACTTTCTCAGCAGAGGATGCTGG - Intronic
934979032 2:98825197-98825219 GGTTCCACAACAGTGGATGGAGG + Intronic
935160169 2:100523240-100523262 GGTTTCTCACTTCTGGAGGCTGG + Intergenic
935211979 2:100946159-100946181 GTTTTATCAGCAGTGGAGGCAGG + Intronic
935955443 2:108372154-108372176 GATTTCTCAGTAGTGGATTCTGG - Intergenic
940784921 2:157971348-157971370 GGTTTCTCAGCCATGGATACTGG + Intronic
942301886 2:174570989-174571011 GGTTTCTCAACTGTGGATGGGGG + Intronic
1171380499 20:24730666-24730688 GAGATATCACCAGTGGATGCTGG - Intergenic
1174750302 20:53105372-53105394 GGCCTCTCCCCAGTGGATGCTGG + Intronic
1180535687 22:16391582-16391604 GGTTTGGCACCAGTGGGAGCCGG - Intergenic
1180880210 22:19198111-19198133 GAGTTATCACCAGTGGATGAGGG - Intronic
1184430800 22:44440708-44440730 GGTTTAGCACCAGAGGCTGCTGG + Intergenic
950391848 3:12702997-12703019 TGTTCCTCAGCAGTAGATGCAGG + Intergenic
950755479 3:15167590-15167612 TATGTGTCACCAGTGGATGCTGG - Intergenic
950841176 3:15969805-15969827 GGTTCCTCAGCAGTGGAGGGAGG + Intergenic
952239376 3:31514387-31514409 GGTATGTGTCCAGTGGATGCCGG + Intergenic
953029963 3:39172832-39172854 GGCTTCTCACCAATAGATGGAGG - Intergenic
953660964 3:44891214-44891236 GGCTTCTCTCCAGAGGGTGCTGG + Intronic
953998578 3:47538776-47538798 GGGTTCCCAGCAGTGGATGCGGG - Intergenic
955182365 3:56683599-56683621 GGCTTCAGAGCAGTGGATGCGGG + Intergenic
955377358 3:58409227-58409249 GGTTTCTGATCAGAGCATGCCGG + Intronic
960159944 3:114339417-114339439 GGCTTCTCACCTGTTGATGTAGG + Exonic
960484515 3:118235186-118235208 GGTTTCTCAACAGGGGACTCTGG + Intergenic
962952869 3:140235615-140235637 GGTTTCTCACCAGAGAATAGTGG - Intronic
963991764 3:151664420-151664442 GGTCTCTCCCCAGGGGATACAGG + Intergenic
965509849 3:169556297-169556319 GGGCTCCCACCAGTGGATGGTGG + Intronic
971225443 4:24747451-24747473 GGGTTCTCACGAAGGGATGCTGG - Intergenic
972520519 4:39850914-39850936 AGTTTCTCCCCTGTTGATGCAGG - Intronic
977080582 4:92522432-92522454 GGTTTTTCAGCAGAGGAAGCAGG + Intronic
980840322 4:138252039-138252061 GTTTTCTCATCACTGGATTCAGG - Intergenic
981747305 4:148063989-148064011 GGTTTCTCACCTGTGGAGTGTGG + Intronic
983361338 4:166727055-166727077 ACTTTCTCACCAGGAGATGCTGG - Intergenic
987962203 5:24824509-24824531 GGTGCCTCAGCAGTAGATGCTGG - Intergenic
991156930 5:63448691-63448713 GGTCTTTCACCAGTGGGTGATGG - Intergenic
991637944 5:68724917-68724939 GGTCTCCCACCACTGGATGGTGG - Intergenic
991947452 5:71913375-71913397 TATTACTCACCAGTGGATCCTGG - Intergenic
995962729 5:117863063-117863085 AGATTTTCACCAGTGGATGTAGG - Intergenic
1001569934 5:172724003-172724025 CATTTATCATCAGTGGATGCCGG + Intergenic
1002198378 5:177513307-177513329 GGTCTCTCACCTGTGGGGGCTGG - Intronic
1002333039 5:178458276-178458298 GGTAGCTGAACAGTGGATGCAGG + Intronic
1003271331 6:4610472-4610494 GGTTACTCACCCGTGGAAGGAGG - Intergenic
1005947151 6:30602899-30602921 GGTTTCCCACCAGGGGGTCCTGG - Exonic
1005985636 6:30872788-30872810 GCTTTATCACCACTGGATGATGG + Intergenic
1007317818 6:41003460-41003482 ATGTTCTCACCAGTGGATGTTGG - Intergenic
1013430907 6:110054179-110054201 GCTTTCTCACCAGTAGTTGAGGG + Intergenic
1014311385 6:119806509-119806531 GCCTTCTCAGAAGTGGATGCTGG + Intergenic
1018781847 6:167075519-167075541 GTTTTCTCTCCATTTGATGCTGG - Intergenic
1019656720 7:2199945-2199967 GATTTGTCACCAGTGACTGCAGG - Intronic
1020361294 7:7329532-7329554 GGTTTCTCAGCAGTGCCTGGGGG - Intergenic
1024326988 7:48116502-48116524 GGCTGGTCACCAGTGGATGTAGG + Intergenic
1024675758 7:51636657-51636679 GGAGTCTGACCAGGGGATGCGGG - Intergenic
1028938390 7:96491156-96491178 ATTTTCTCATCAGTGGATTCTGG + Intronic
1029634227 7:101773209-101773231 GTTTTCTCACCTGTGGATGATGG - Intergenic
1031458249 7:122011297-122011319 GGTGTCTCACCATTGTATACCGG - Exonic
1032283284 7:130523427-130523449 TGATTCTCACCCGAGGATGCAGG - Intronic
1032284030 7:130527653-130527675 TGATTCTCACCCGAGGATGCAGG - Intronic
1032284802 7:130532030-130532052 TGATTCTCACCCGAGGATGCAGG - Intronic
1032285597 7:130536562-130536584 TGATTCTCACCCGAGGATGCAGG - Intronic
1035640172 8:1178829-1178851 GGTTTCTCACAAGAGGGTGTGGG + Intergenic
1037822638 8:22142317-22142339 GGTCTCACACCAGTGGGTCCAGG + Intergenic
1038467347 8:27776587-27776609 GCTTTCTCTCCAGTGGATTGAGG - Exonic
1040629966 8:49198928-49198950 GGTTTCACACCAGTGTGTGCTGG + Intergenic
1041570238 8:59329923-59329945 GGTTTCTAATCAGTGATTGCTGG + Intergenic
1043163994 8:76880351-76880373 GATTTCTCACTGGTGGATGCTGG + Intergenic
1043344323 8:79282123-79282145 GGTTTCTCACCTGTGAAAGCGGG + Intergenic
1045890385 8:107149366-107149388 TGTTTCTCACCATTGGGTGTAGG - Intergenic
1046531889 8:115456931-115456953 GTTTTCTCATTAGTGGAAGCTGG - Intronic
1047064346 8:121263707-121263729 GGTTACTCACCAGTACATACTGG + Intergenic
1047787798 8:128170627-128170649 AGTGTCTCATCAGTGGCTGCAGG - Intergenic
1048124148 8:131614291-131614313 TGTTTGGCACTAGTGGATGCAGG - Intergenic
1048505925 8:135021515-135021537 GGTTTCTCAACAGCCCATGCAGG - Intergenic
1048744179 8:137594742-137594764 TGTTTCTCTCTAATGGATGCTGG + Intergenic
1049397518 8:142408174-142408196 GGTTTCTCACCTGTGGAATGAGG - Intergenic
1049731711 8:144181570-144181592 TCTTTCTCACCTGTGGATGAGGG + Intronic
1055424193 9:76176717-76176739 GCTTTCTAACTAGTGTATGCTGG + Intronic
1059379693 9:113913458-113913480 GGTTCCTCACAACTGGATACTGG - Intronic
1060994128 9:127866728-127866750 GGGTTCTCCCCAGGGGATTCTGG + Exonic
1186930051 X:14379250-14379272 GGTTTCTCACTGGTGGATAAAGG + Intergenic
1194237260 X:91399560-91399582 GGTCTCTCAGCTGTGGATACCGG - Intergenic
1195840199 X:109167927-109167949 GGTTCCTAAGCAGTGCATGCTGG + Intergenic
1196590430 X:117481204-117481226 GGTCTCTCAGCCGTGGATACCGG + Intergenic
1197666088 X:129224958-129224980 GATTTCTGACCAGTGGGTACAGG - Intergenic
1198036257 X:132804285-132804307 GGGTTCTAAGCAGTGGATGGTGG - Intronic
1198402391 X:136280402-136280424 GGTTTCCCATTAGTGGAAGCTGG - Intergenic
1199575147 X:149306734-149306756 GCTTTGTCACCAATGGATGATGG - Intergenic
1202150801 Y:21842204-21842226 GGTGTGTCAGCAGTGGATTCTGG - Intergenic