ID: 1124870980

View in Genome Browser
Species Human (GRCh38)
Location 15:33542285-33542307
Sequence CTGTGTGAGTAGGATATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124870978_1124870980 -3 Left 1124870978 15:33542265-33542287 CCAGCACTTGGCAGTGTTCTCTG 0: 1
1: 0
2: 1
3: 27
4: 202
Right 1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124870980 Original CRISPR CTGTGTGAGTAGGATATTGA TGG Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
905295555 1:36952199-36952221 CTCTTTGAGTAGGGTTTTGAGGG - Intronic
906789237 1:48644281-48644303 CTGTGTGAGATGAATCTTGAAGG - Intronic
909971900 1:82000890-82000912 CAGTGTGAATAGGACATTGCTGG - Intergenic
912159690 1:106966705-106966727 CTGTGTGAGTGTGGTAATGAAGG - Intergenic
915888305 1:159747277-159747299 CTGTGTGAGGATGATAATGCAGG - Intergenic
916869184 1:168893798-168893820 CTGTGTGAGGAGTATGTTGTAGG - Intergenic
916897559 1:169181352-169181374 GTGTGTGTGTAGGAATTTGAGGG - Intronic
917187593 1:172377886-172377908 TTGTGTGAAAAGCATATTGATGG - Intronic
917459801 1:175220258-175220280 GTGTGTGTGTAGCATCTTGAAGG - Intergenic
920442974 1:205993805-205993827 CTGTGTGTGTAGGACATGGGAGG + Intronic
921796019 1:219345875-219345897 GTGTGTGAGTATCACATTGAGGG - Intergenic
1066322468 10:34317843-34317865 CTGTGTGAGCAGGATATGTTGGG - Intronic
1067275314 10:44828555-44828577 CTCTGTAAGTAGGATATTAAGGG + Intergenic
1070149936 10:73799394-73799416 CTGGGTGAGTGAGATACTGAGGG - Exonic
1073469345 10:103713173-103713195 CTCTGTAAGTTGGATCTTGAGGG - Intronic
1073553681 10:104427479-104427501 CTCTGTGAGATGGATGTTGATGG + Intronic
1075228074 10:120647595-120647617 CTGTGCGAATCCGATATTGATGG - Intergenic
1075666562 10:124234748-124234770 CTGCGTGAGCAGGACATTGACGG + Intergenic
1075759759 10:124846923-124846945 CTTTTTTCGTAGGATATTGAAGG + Intergenic
1076522947 10:131092247-131092269 CTGTGTGAGTGGCATTTTCATGG + Intergenic
1076742403 10:132493227-132493249 CTGTGTGAGATGGAGACTGAGGG - Intergenic
1077294781 11:1821089-1821111 CTGAGTGAGTAGGATGGTGCAGG - Intergenic
1077489239 11:2852880-2852902 CTGAGGGAGAAGGATCTTGAGGG - Intergenic
1082311545 11:50655659-50655681 CTGTTTTTGTAGAATATTGAAGG + Intergenic
1083434124 11:62631030-62631052 CTGTGAGACTAGCATATTGCCGG + Exonic
1083640223 11:64141435-64141457 CTGTGTGCCTAGGATATGAAGGG - Intronic
1084702404 11:70796028-70796050 CTGTGGGAGGAGGTTATTTAAGG - Intronic
1091875138 12:3927532-3927554 CAGTGTGCCCAGGATATTGAGGG - Intergenic
1092511705 12:9163571-9163593 TTGTGTGAGCATGATATTAATGG + Intronic
1092922842 12:13247671-13247693 ATGTGTGAGATGGATATTAAGGG - Intergenic
1096586987 12:52629258-52629280 CTGTGTGAGATGGATATTCAGGG - Intergenic
1096967051 12:55637019-55637041 CTGTGTGAGGAGGATGATCAGGG - Exonic
1097473569 12:60025552-60025574 TTGTGTTAGTAGGATAGGGAAGG + Intergenic
1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG + Intronic
1099278225 12:80606055-80606077 GTGAGTGAGTAGGATAATTAAGG + Intronic
1102155623 12:110725381-110725403 TGGTGTCAGTAGGTTATTGAGGG - Intronic
1102614210 12:114138859-114138881 CTGTATGGGTAGGGTATGGAAGG + Intergenic
1106344289 13:28860687-28860709 CTGTGTGTGCTGGATATTGGAGG + Intronic
1107291566 13:38860185-38860207 TTGGGTGAGTAGGATTTTGCTGG + Intronic
1109338280 13:61021242-61021264 CTGTGATAATAGGTTATTGATGG - Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1112430854 13:99349029-99349051 CTGTGTGCTCAGGATATTGTTGG + Intronic
1116798450 14:49416398-49416420 CTGGGTAAGTTGGATATTGCTGG + Intergenic
1117210005 14:53486785-53486807 CTTTGGTAGTAGGATAATGACGG - Intergenic
1119035294 14:71225284-71225306 GGATGTGAGTAGGATGTTGATGG - Intergenic
1120671828 14:87371471-87371493 CTGTGTGAGTGGAGTCTTGAAGG + Intergenic
1122920785 14:104879211-104879233 CTCTGTGAGTGAGATATTTAGGG + Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1125197631 15:37066704-37066726 CTGTGTGATTAGGATGTTAGGGG - Intronic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1127661794 15:61106518-61106540 ATGGGTGAGTAGGATTTGGATGG - Intronic
1127967890 15:63937419-63937441 TAGTGTGAGTGGGTTATTGATGG - Intronic
1129121973 15:73403906-73403928 CTGTGTTGGTAAGATGTTGAGGG + Intergenic
1129166494 15:73781177-73781199 CTGTGTGAGGCTGACATTGATGG - Intergenic
1131132993 15:89912285-89912307 CTGGGTGAGGAGGATTTGGAGGG - Intronic
1138784354 16:59828830-59828852 CTGTGTGCTTAGGATGATGAAGG + Intergenic
1139436400 16:66939100-66939122 ATGTGTGAGCAGGATATTGTGGG + Intronic
1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG + Intergenic
1142107574 16:88313631-88313653 CTGTGTGATTATGATAATGCTGG + Intergenic
1143442344 17:6984949-6984971 GTGTGTGTGTATGATTTTGATGG - Intronic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1148193622 17:45697823-45697845 CTGTGTGGGTGACATATTGAAGG - Intergenic
1149758943 17:59211414-59211436 CTGTATGAGGTGGCTATTGATGG + Exonic
1153579127 18:6553904-6553926 CCGTCAGAGTAGCATATTGATGG + Intronic
1155261584 18:24048497-24048519 CTGTATGAGTAGGAAATTAAAGG + Intronic
1168067381 19:53925851-53925873 ATGTGAGAGAGGGATATTGATGG + Intronic
925170323 2:1746088-1746110 ATGTGTGAATAGGATCTTGCAGG - Intergenic
929258590 2:39839804-39839826 ATGTGTGACTAGGATTTTAAAGG + Intergenic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
932641226 2:73449237-73449259 CTGTGTGAGTAGAAACTAGATGG - Exonic
941624716 2:167818701-167818723 CTGTGTGAGGAGGAGATTCAAGG - Intergenic
943451201 2:188044411-188044433 CTGTGTGAGCAGGATAAAGCAGG + Intergenic
944113223 2:196158140-196158162 CTGTGTTAGAAATATATTGAAGG - Intronic
945036322 2:205706970-205706992 CTGTGTGAGTCAGACCTTGAAGG - Intronic
945936618 2:215908825-215908847 CTGTGTGAGCAGGAGTTTAAGGG + Intergenic
1169746968 20:8952507-8952529 CTGGGGGAATAGGATAATGAGGG - Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1174372173 20:50098394-50098416 CTGTGTGAGGATGAGAGTGAAGG + Intronic
1177237126 21:18406344-18406366 CTGTGTGAGTAGAACATCCAGGG + Intronic
1180370446 22:12030213-12030235 GTGTGTGTGTATGATATTGTAGG + Intergenic
1181553313 22:23653271-23653293 CTGTGGGAGGTGGATATTCAAGG - Intergenic
1181607311 22:23988502-23988524 GTGTGTGAGTAGGATGTTGAGGG - Intergenic
1181955240 22:26583507-26583529 CTGTGTTTCTAGGATATTGGAGG - Intronic
1182432079 22:30305175-30305197 AAGTGTGTGTAGGATTTTGATGG - Intronic
950538209 3:13594172-13594194 GTGGGTGGGTAGGATACTGAGGG + Intronic
952777823 3:37063203-37063225 CTGTGTGAGTAGTGTTTAGAGGG + Intronic
955874323 3:63474193-63474215 CAGTGTGAGAAGGAAATTGGTGG - Intronic
957862250 3:85969107-85969129 CTATGTGAGAAAGAGATTGAAGG - Intronic
957866548 3:86031980-86032002 CTGAGTGGGGAGGATGTTGACGG + Intronic
960842469 3:121974134-121974156 CTGTGTGTGTTAGACATTGAAGG - Intergenic
963166049 3:142204660-142204682 TTGTGTGATTTGGATATTGTTGG - Intronic
964411136 3:156398997-156399019 CTTGGTGGGTAGGAGATTGATGG - Intronic
965887724 3:173468933-173468955 GTGTGTGACTAGGGTATTGCAGG + Intronic
969719018 4:8882892-8882914 AAGTGTGAGAAGGATTTTGAAGG + Intergenic
974652176 4:64768311-64768333 TTGTGTGAGTAAAATATTCAAGG - Intergenic
974915814 4:68176962-68176984 CTCTGTGATTAGGATTGTGAAGG + Intergenic
978165692 4:105603787-105603809 CTGTGGCAGTAGGAAAGTGATGG - Intronic
978643964 4:110906680-110906702 CTTTGGTAGGAGGATATTGAAGG - Intergenic
979483802 4:121247970-121247992 CTATGTGAGGAGGAGGTTGAAGG + Intergenic
983832550 4:172346344-172346366 CTGTGTGAGGGACATATTGAAGG - Intronic
985703672 5:1388487-1388509 ATGTGTGGGTAGGTTATGGACGG - Intergenic
988873737 5:35420227-35420249 CTGTGTGTGAAGGGTGTTGAGGG - Intergenic
994294944 5:98080057-98080079 ATGTGTGATTTGGATCTTGATGG - Intergenic
994545351 5:101159952-101159974 CTGGGTGATTTGGATATAGAGGG + Intergenic
995457069 5:112363127-112363149 CAGTGTGAGTGGGACATTCAGGG + Intronic
996936519 5:128955739-128955761 CTGTGTGATGAGCATATTGAGGG + Intronic
997135575 5:131321677-131321699 CTGGGTGGGTAGGATAATGGTGG + Intronic
1001407197 5:171484540-171484562 CTGGGTGGGGAGGATAGTGAAGG - Intergenic
1003357353 6:5386224-5386246 TGGTGTGAGTAGCAGATTGAAGG + Intronic
1005003108 6:21262694-21262716 ATGTGTGAGCAGGGTTTTGAAGG - Intergenic
1005482436 6:26267512-26267534 CTGTGTGAGGTGGGAATTGAAGG + Intergenic
1005640863 6:27794813-27794835 TGGTGTGAGAAGGAGATTGAGGG + Intergenic
1009388199 6:63112037-63112059 TAGTGTGAGTAAGACATTGACGG + Intergenic
1009973621 6:70650879-70650901 CAGTGTCAGTAGGGCATTGAAGG - Intergenic
1012951002 6:105517956-105517978 CTGGGTCAGTAGCATATGGACGG - Intergenic
1013043310 6:106458365-106458387 CTGTTTGAGCAGGATCTTAAAGG - Intergenic
1013749616 6:113388471-113388493 CTGTGTGACAAAGATGTTGATGG - Intergenic
1014160736 6:118165302-118165324 CTGTGTGAGTAGGAAAAAGCTGG - Intronic
1015430811 6:133128746-133128768 CTGTGTAAGTTTGATAATGAGGG - Intergenic
1017015436 6:150095850-150095872 CTAGGTGGGAAGGATATTGAGGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1020466893 7:8490062-8490084 CTAAGTCAGTAGGATACTGAAGG - Intronic
1020505588 7:8983204-8983226 GTGTGTCATTTGGATATTGAAGG + Intergenic
1022411210 7:30139896-30139918 CTGTGTGTGGAGGAAATTCAAGG + Intronic
1022587473 7:31628212-31628234 CGGTAGGAGTAGGAGATTGAAGG - Intronic
1023766555 7:43517123-43517145 CAGTGTGAGAAGGATTTTCAGGG + Intronic
1026434158 7:70379580-70379602 CTGTGTGTGTAGGTTCTGGAAGG + Intronic
1028284005 7:88971710-88971732 ATGTGTGAGTAGAATATAGGTGG - Intronic
1028494430 7:91448129-91448151 GTGTGGTAGTAGGATAATGAAGG + Intergenic
1031851947 7:126876055-126876077 AAGTTTGAGTAGGATATTCAAGG - Intronic
1033557723 7:142503291-142503313 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1033560178 7:142523348-142523370 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1035110339 7:156476309-156476331 CTGCCTGAGTAGGGCATTGATGG - Intergenic
1046511124 8:115204081-115204103 ATTTGTGAGTAGCATACTGATGG + Intergenic
1048579965 8:135722677-135722699 GTGTGTGTGTGGGATATTGAGGG + Intergenic
1053385411 9:37683521-37683543 AAGTGTGAGTAGGAATTTGATGG + Intronic
1057178046 9:93013684-93013706 ATGTTTGAGTTGGGTATTGAAGG - Intronic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059706347 9:116826726-116826748 CAGTGTTAGTAGGTTTTTGAGGG - Intronic
1186099485 X:6140435-6140457 CTGTGTGTGAATGCTATTGAAGG - Intronic
1187469721 X:19558334-19558356 ATGTGTGAGGAGGATATACAAGG - Intronic
1188874098 X:35408690-35408712 ATGTGTGATTAGCTTATTGAAGG + Intergenic
1190637373 X:52449450-52449472 CTGTGTTTGTAGGATTTTGAAGG - Intergenic
1190648657 X:52546809-52546831 CTGTATTTGTAGGATTTTGAAGG + Intergenic
1190679683 X:52814349-52814371 CTGTGTTAATAGGATATGGAAGG + Intronic
1191159716 X:57316011-57316033 CAGTTTTAGTAGGATTTTGATGG - Intronic
1193107119 X:77688594-77688616 CTGTGTAAATAGGATTTGGATGG - Intronic
1195742046 X:108074718-108074740 CTATTTGAGCAGGATCTTGAAGG + Intronic
1197599389 X:128509812-128509834 CTGTGTGAGTCAGTGATTGAGGG - Intergenic
1198215449 X:134550395-134550417 ATTTGTGAGAATGATATTGAAGG + Intergenic
1198407381 X:136327183-136327205 CTCTGTGAAGAGGATAGTGAAGG - Intronic
1201771144 Y:17618146-17618168 CTGTGTGAGGAGGTTATTCCAGG + Intergenic
1201830411 Y:18287840-18287862 CTGTGTGAGGAGGTTATTCCAGG - Intergenic