ID: 1124871284

View in Genome Browser
Species Human (GRCh38)
Location 15:33545528-33545550
Sequence TATTTTATAAGGAAGCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124871284 Original CRISPR TATTTTATAAGGAAGCGTGA AGG Intronic
905051997 1:35059947-35059969 AATTATATAAGTAAGGGTGAGGG - Intronic
906554690 1:46699687-46699709 TATCTTATAAGGATACGTGATGG + Intronic
906625401 1:47320949-47320971 TATTTTATAATGAATAGAGATGG - Intergenic
908465666 1:64391238-64391260 TATCTAATAAGGCAGCTTGAGGG + Intergenic
909565282 1:77046678-77046700 CATTTTATAAGGAATCAAGAAGG + Intronic
910988250 1:93027551-93027573 TATTTTATAAGGAAGAGATATGG - Intergenic
911169347 1:94754946-94754968 TATTTTATATGCAAGAGGGAAGG - Intergenic
911208145 1:95113382-95113404 TATGTTGCAAGGAAGCATGAGGG + Intergenic
911490321 1:98557260-98557282 TATTTTATAAGGAAAAGAGTAGG + Intergenic
912669386 1:111610116-111610138 ATTTTTCTAAGGAAGAGTGAGGG - Intronic
913184643 1:116358586-116358608 AATTTTATAAGAAAGCATAAAGG - Intergenic
915559853 1:156680672-156680694 TATTTTAAAAGGGACCTTGATGG + Intergenic
915773847 1:158460836-158460858 TTTTTTACTAGGAAGAGTGAGGG + Intergenic
916603726 1:166320216-166320238 TATTGTAGAAGGAATAGTGAAGG - Intergenic
919112396 1:193237254-193237276 TATTTTCTAAGGAAAAATGATGG - Intronic
919328725 1:196141733-196141755 TATTTTATGAGGAAACCTCAAGG + Intergenic
923401352 1:233618219-233618241 TCTTTTAGAATGAAGGGTGATGG - Intronic
923688976 1:236175024-236175046 TATTTTCTGAGGAAGAGTGTAGG + Intronic
1063472746 10:6301366-6301388 TTATTTATAAGTAAGGGTGAAGG - Intergenic
1063709087 10:8459698-8459720 TATTTTAAAATAAAGCATGATGG + Intergenic
1064858294 10:19796377-19796399 TATTTTAAAAAGAAGCCTCATGG - Intergenic
1064897222 10:20250939-20250961 TTTTATATAAGGAAGAGTGTTGG - Intronic
1065633968 10:27711876-27711898 TGTTTTATAAGAAAAAGTGAAGG - Intronic
1066409024 10:35147633-35147655 TATGTTATGAGGTAGTGTGAAGG - Intronic
1068415642 10:56718140-56718162 GATTTTCTAAGGAAGAATGAAGG - Intergenic
1072095487 10:92174670-92174692 ACTTTGATAAGGAAGAGTGAGGG + Intronic
1073341534 10:102748454-102748476 TATTGTATAAGGAGGAATGATGG - Intronic
1073640382 10:105246678-105246700 AATTTTATACAGAAGCGTGCAGG + Intronic
1076229765 10:128810328-128810350 TAATTTTGAAGGAAGTGTGATGG - Intergenic
1077653197 11:3993344-3993366 TATTTTATATGGAAATATGAGGG - Intronic
1078823753 11:14907083-14907105 TATTTCATGAGGAGGTGTGAAGG + Intronic
1079312069 11:19375712-19375734 TGTTTTATTAGGTAGTGTGACGG - Intronic
1079919792 11:26418756-26418778 TATTTTATATATAAGCTTGAAGG - Intronic
1080117572 11:28637950-28637972 TATTTTGTAATGCAGCATGATGG + Intergenic
1082724946 11:56723399-56723421 TATTCTTTAAGAAAGTGTGAAGG + Intergenic
1089311797 11:117562934-117562956 TATTTTATAAGGATGTTGGAAGG + Intronic
1091643673 12:2256862-2256884 TATTTTAAAAGGTAGCATGCTGG - Intronic
1092437252 12:8459997-8460019 TATTTTATGATGGAGGGTGAGGG - Intronic
1093917014 12:24815598-24815620 TATTTAACAAGAAAGCGTCAAGG + Intronic
1094772949 12:33686769-33686791 TATTTTTTAAGGAAGCCAAATGG + Intergenic
1098212818 12:68184455-68184477 TATGGTATAAGCAAGCGAGATGG - Intergenic
1098267962 12:68742356-68742378 TATTTTCTAAGGAAGAGCTAAGG + Exonic
1099453224 12:82833184-82833206 TATTTTTTAAGGTAGCAAGATGG + Intronic
1100512797 12:95293609-95293631 TATTTTGTGAAGAAGAGTGATGG + Intronic
1101185749 12:102277003-102277025 TAATTTTTAAGGAAACGTGGTGG - Intergenic
1101669744 12:106857498-106857520 TATTTTATCAGGATGCTAGAGGG - Intronic
1102689912 12:114752148-114752170 TATTTTATTAGGAAGCCTCCAGG - Intergenic
1106167239 13:27258947-27258969 TTTTTTCTAATGAAGCGAGATGG + Intergenic
1108937743 13:55905242-55905264 TATTTTATATTGAACCGTGAAGG + Intergenic
1113198897 13:107842573-107842595 TCTTTTATAAGGCATTGTGAGGG - Intronic
1113292731 13:108924008-108924030 GATTTTATGAGGAAGCTTCATGG - Intronic
1114468936 14:22945461-22945483 TTTTTAATTAGCAAGCGTGATGG - Intergenic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120431577 14:84424198-84424220 AATTTTATATGGAAGAGTAAAGG + Intergenic
1123797326 15:23784751-23784773 CTTTTTATAGGGAAGGGTGAGGG + Intergenic
1124149649 15:27166136-27166158 TATTTTAGAAGGAAGTTGGATGG + Intronic
1124871284 15:33545528-33545550 TATTTTATAAGGAAGCGTGAAGG + Intronic
1128473948 15:67981085-67981107 TATAATATAAGGAAGAGAGATGG - Intergenic
1128930115 15:71696828-71696850 TGATCTATAAGGAAGAGTGAAGG + Intronic
1133716428 16:8453894-8453916 TATTTTTTAAGGAACTGTAATGG - Intergenic
1135637104 16:24087243-24087265 TGTTTAAGAAAGAAGCGTGAAGG - Intronic
1139011568 16:62641551-62641573 TATTTTAAAAGTAAGTGTGACGG + Intergenic
1140687650 16:77449037-77449059 TGTTTAAAAAGGAAGAGTGAGGG - Intergenic
1141686547 16:85573622-85573644 TATTTTATTTGGAAACTTGAAGG + Intergenic
1146493069 17:33296073-33296095 AATTTTGTAAGGAAGTATGATGG - Intronic
1146510352 17:33442301-33442323 AATTTTCTAAAGAAGCCTGATGG + Intronic
1149325120 17:55522319-55522341 TCTTTTATAAGGAATGGTCATGG - Intergenic
1151256304 17:72879342-72879364 TCTTTTGTATGGAAGCGAGATGG - Intronic
1152147718 17:78578602-78578624 GATTTTATAGGGAAGTATGAGGG + Intergenic
1156551411 18:38022782-38022804 GATTTGATAATGAAGAGTGAAGG - Intergenic
1156864907 18:41877981-41878003 TGTTTTATAAGTAAGTCTGAGGG + Intergenic
1157440442 18:47707554-47707576 CATTCAATAAGGAAGTGTGATGG + Intergenic
1158484456 18:57852908-57852930 AATTTTATATGGAAATGTGAAGG - Intergenic
1159099718 18:63944530-63944552 CTTTTTATAAAGAAGCTTGATGG + Intergenic
1159709550 18:71739429-71739451 TATTTTAAAAGTAAGTGTAATGG - Intronic
1160601978 18:80020725-80020747 TATTTTATAAGGCAGTATAAAGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1164802492 19:31089237-31089259 TATTATATAAGAAAGAGAGATGG - Intergenic
1167070357 19:47218429-47218451 TATGTTACAAGGAAGCCGGAAGG - Intergenic
925806545 2:7656009-7656031 TATTTTATAAAGAAGGGTGAAGG - Intergenic
926423211 2:12718195-12718217 GATTTTAAAAGGGAGCGAGAGGG - Exonic
931369270 2:61647053-61647075 TATTTTAAAAGAAGGGGTGAGGG + Intergenic
932232586 2:70094894-70094916 TATTTTGTATGGAAGGCTGAAGG - Intergenic
940594238 2:155769202-155769224 TATTTTAGAAGGAATCCTTAGGG - Intergenic
942956342 2:181778490-181778512 TATTTTTAAAGGAAAGGTGAAGG - Intergenic
942961640 2:181836676-181836698 TATTTTAAAAGGTTGTGTGAAGG - Intergenic
943129539 2:183839128-183839150 TATTTTAAATGGAAGCTGGAAGG - Intergenic
943314706 2:186372600-186372622 TATTTTAAAAAAAAGAGTGAGGG + Intergenic
944041300 2:195357988-195358010 TATTTCATGAGGAAGGGTGGAGG - Intergenic
944983072 2:205144427-205144449 TAATTCATAAGGAAAAGTGAAGG - Intronic
948791633 2:240381540-240381562 CATTTTATCAGGAAGTGTGTTGG - Intergenic
1169327617 20:4687490-4687512 TGTTTAATAATGAAACGTGAAGG - Intronic
1174591722 20:51650565-51650587 TATATTTTAATGAAGCGTGAGGG + Intronic
1174776429 20:53347071-53347093 TTTTGTATAAGGTAGGGTGAGGG - Intronic
1176910158 21:14555405-14555427 TGTTTTAAAAGGCAGGGTGAAGG - Intronic
1177019964 21:15841980-15842002 GATTTTGTCAGGAAGTGTGAAGG + Intronic
1177378590 21:20307150-20307172 TATTTTATATAAAAGCATGATGG - Intergenic
1177458411 21:21375457-21375479 TATTTTTTTAGAAAGTGTGATGG - Intronic
1177600097 21:23299598-23299620 AATTTTAAAAGGCAGCATGAAGG - Intergenic
1182991030 22:34767965-34767987 AATGTTATAAGAAAGCTTGAAGG + Intergenic
950836075 3:15920215-15920237 TAGTTGATAAGGAACCTTGAGGG - Intergenic
952405408 3:33000338-33000360 TATTTTTTAAAAAAGTGTGAAGG + Intronic
952703941 3:36357684-36357706 TAGTGTATAAGGAAGTGAGAAGG - Intergenic
954827080 3:53383507-53383529 TAATTTGTAAGGAAACATGAGGG + Intergenic
955317210 3:57948849-57948871 TCTTTTATAAGCAAGGGAGAGGG + Intergenic
958634481 3:96725715-96725737 TATTTTCAAAGGAAGTGAGAAGG + Intergenic
959144231 3:102524512-102524534 TATTCTTTGAGGAAGGGTGAGGG - Intergenic
959991530 3:112637395-112637417 CATTTTAAAAGGATCCGTGAGGG + Intronic
960529122 3:118743461-118743483 TATTTTCTAAGCAAGTTTGAAGG - Intergenic
964339589 3:155694080-155694102 TATTTTATACTGAATCTTGAAGG - Intronic
970581799 4:17480304-17480326 AATTTTATATGGAAGTATGACGG - Intronic
975849412 4:78556530-78556552 TATTTTATAAGTAAGGTGGAGGG + Intronic
976071409 4:81244104-81244126 TATGTTTTCAGGAAGCCTGATGG + Intergenic
978881174 4:113704602-113704624 TATTTGAGAAGGAAGTGAGAAGG + Intronic
979653370 4:123162702-123162724 TATTTTATAAGGAGTCATCATGG + Intronic
981642855 4:146965829-146965851 CATTTTATAAGGAAGCTGGTTGG - Intergenic
981765446 4:148243548-148243570 TAGTATATAAGGAAGTGTCATGG - Intronic
984157877 4:176213626-176213648 TATTTTATAATGAAAAGTCATGG - Intergenic
988519811 5:31935579-31935601 TATTTTATAAAGAAGTCTGTTGG - Intronic
989987809 5:50722494-50722516 TATTATATGAGGAAGAGTGGGGG - Intronic
990863343 5:60352732-60352754 TATTTTATAAGGAAAATTAATGG + Intronic
992387266 5:76296873-76296895 TATTTTATGTGGGAGAGTGAAGG - Intronic
993007958 5:82448513-82448535 TAGTTTATTAGGAACCGTGTAGG + Intergenic
995950097 5:117701518-117701540 TATTTTTTAATGAAGCAGGAAGG + Intergenic
996644864 5:125801081-125801103 AATTTTAGAAGGAAGAATGAAGG - Intergenic
997701194 5:135901160-135901182 TACTTTCTAAGTAAGCATGATGG + Intergenic
998226658 5:140332220-140332242 TATGTTATATGGAAGCAAGATGG + Intergenic
998673855 5:144385104-144385126 TATCTTACAATGAAGTGTGAAGG - Intronic
998978427 5:147673620-147673642 GATTTGCAAAGGAAGCGTGAAGG - Intronic
1005825605 6:29630059-29630081 AATTATATAAGGAATGGTGAGGG + Intronic
1008472918 6:51903910-51903932 TATTTTATAGACAAGCCTGATGG - Intronic
1009810889 6:68664823-68664845 TATTGCATAAGGGAGGGTGAAGG + Intronic
1012803406 6:103864742-103864764 TATTTTATAAGGAAAAGCAAGGG + Intergenic
1018494168 6:164331433-164331455 TATTTTATAAGGAAGATTTCAGG + Intergenic
1018647689 6:165963414-165963436 TATTTTAAAAAGTGGCGTGAAGG + Intronic
1021029604 7:15714950-15714972 TATCTTAAAAGGAAGTGTGATGG + Intergenic
1023544845 7:41307450-41307472 AATTTAATAATGAAGCCTGAGGG + Intergenic
1024641782 7:51334921-51334943 TATTTTGCAAGGAAGCCTTATGG - Intergenic
1024884915 7:54129951-54129973 TATTTACTTAGGAAGCATGAAGG + Intergenic
1027663943 7:81021436-81021458 TATTATATAAGGTAGCAAGAAGG + Intergenic
1030185595 7:106758729-106758751 TCTTTTATGAGGAAGGGTCAGGG - Intergenic
1031482069 7:122290096-122290118 TATTTTACAAGAAAGCCTAAGGG - Intergenic
1031943150 7:127810752-127810774 TATTTTATAAGATAGCTGGAGGG - Intronic
1032786223 7:135202246-135202268 AATTTTAGAGGGAAGCTTGAAGG - Intronic
1040427689 8:47305183-47305205 TAATTTTTCAGGAAGTGTGAAGG + Intronic
1041963278 8:63645288-63645310 TATTTTTTCAGGAATCATGATGG + Intergenic
1042069588 8:64916257-64916279 TATTTTAAAAGGAAGACAGAGGG - Intergenic
1042748346 8:72131886-72131908 TATTTAATAAGGAAACTTGAAGG + Intergenic
1045691773 8:104766683-104766705 TATTTTTTAAGGAAGGCTGATGG + Intronic
1048188872 8:132270066-132270088 TGTTTAATAAGAAAGCGGGAAGG - Intronic
1048643771 8:136394469-136394491 GATTTGATAAGGAAGCCTAAAGG + Intergenic
1049078386 8:140419531-140419553 TCTTTTATCATGAAGCATGATGG - Intronic
1049921889 9:372601-372623 TCTTTTATAAGGATCCTTGATGG - Intronic
1051613160 9:18981252-18981274 TATTTTATAACTAAGAGTGGGGG - Intronic
1057426406 9:94953696-94953718 TATTTTAAAAGGTAGTGTGGTGG - Intronic
1060363323 9:122982240-122982262 TAGTTTTTAAGGAAGAGTTAAGG + Intronic
1062342147 9:136098520-136098542 TCTTTCATAAGGAAGGGTCAGGG - Intergenic
1188685944 X:33070476-33070498 TATTTAATAAGGAAGCTTATTGG - Intronic
1188925825 X:36042821-36042843 AATTTTATATGGAAGGGTCAAGG + Intronic
1189093627 X:38114056-38114078 TATTTTATTAGGAAGGGTACTGG - Intronic
1195328366 X:103776367-103776389 TATTTTCCAAGGAATCGGGAGGG + Intronic
1197521235 X:127499376-127499398 TATCTTAAAATGAAGAGTGAAGG - Intergenic
1198561574 X:137856169-137856191 CATTTTATTAGGAGGCCTGATGG - Intergenic