ID: 1124873880

View in Genome Browser
Species Human (GRCh38)
Location 15:33572532-33572554
Sequence ATGGCAAAACAGCTCCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124873880_1124873892 1 Left 1124873880 15:33572532-33572554 CCCTGTTGGAGCTGTTTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1124873892 15:33572556-33572578 AGGCGGTGGGGGGAGGGAGATGG 0: 1
1: 1
2: 30
3: 956
4: 4378
1124873880_1124873890 -5 Left 1124873880 15:33572532-33572554 CCCTGTTGGAGCTGTTTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1124873890 15:33572550-33572572 GCCATGAGGCGGTGGGGGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 400
1124873880_1124873887 -10 Left 1124873880 15:33572532-33572554 CCCTGTTGGAGCTGTTTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1124873887 15:33572545-33572567 GTTTTGCCATGAGGCGGTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 130
1124873880_1124873893 14 Left 1124873880 15:33572532-33572554 CCCTGTTGGAGCTGTTTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1124873893 15:33572569-33572591 AGGGAGATGGAAGCATCAACAGG 0: 1
1: 0
2: 2
3: 23
4: 254
1124873880_1124873888 -9 Left 1124873880 15:33572532-33572554 CCCTGTTGGAGCTGTTTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1124873888 15:33572546-33572568 TTTTGCCATGAGGCGGTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1124873880_1124873889 -6 Left 1124873880 15:33572532-33572554 CCCTGTTGGAGCTGTTTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1124873889 15:33572549-33572571 TGCCATGAGGCGGTGGGGGGAGG 0: 1
1: 0
2: 1
3: 39
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124873880 Original CRISPR ATGGCAAAACAGCTCCAACA GGG (reversed) Intronic
900737539 1:4308645-4308667 ACGGCCACACAGCCCCAACATGG - Intergenic
904473907 1:30752270-30752292 ATGGGAAAACAGGTCCAGCAGGG - Intronic
908012485 1:59793553-59793575 ATAGCAAAACAGTTCTACCAGGG + Intergenic
908290732 1:62664557-62664579 ATGACAAAAAAACTCCTACACGG + Intronic
911775735 1:101809647-101809669 ATGGAAACACAGTTCCAAGAGGG + Intronic
917161996 1:172067966-172067988 ATGACTAAACAGCTCAAAAATGG - Intronic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
921529305 1:216261018-216261040 ATGGTAAAACATTTCCAAAATGG - Intronic
922226869 1:223653021-223653043 AAGTTAAAACATCTCCAACAAGG + Intronic
922623260 1:227008638-227008660 ATGGCAAAACAACTAAAAAAGGG + Intronic
1063760255 10:9066926-9066948 AAGGCAGAACAGCTCCCGCAGGG + Intergenic
1064861265 10:19828661-19828683 ATTGCAAAACAGCTCCATGCAGG + Intronic
1065603905 10:27395956-27395978 ATTGCAAAACAGCAAAAACATGG + Intergenic
1066021475 10:31307979-31308001 ATGGGAAAACAGATTCAACAAGG + Intergenic
1066231043 10:33433453-33433475 GAAGCAAAACAGGTCCAACAAGG - Intergenic
1066344788 10:34573893-34573915 ATGTCAAAACACCTCCCACTGGG - Intronic
1066994368 10:42550675-42550697 CTGGCAAAACATCTCTAAAAGGG + Intergenic
1067759530 10:49033684-49033706 ATGGCAGAGCTGCTCCAACCAGG - Intronic
1070485693 10:76928910-76928932 CAGGCAAAACAGCTCCAAGAGGG + Intronic
1072807500 10:98433778-98433800 ATGGTAAAACAGCTCGATCCTGG - Intronic
1075573752 10:123563541-123563563 CTGGGAAAACAGACCCAACAAGG - Intergenic
1075847186 10:125554497-125554519 TTTGCAAAAATGCTCCAACATGG - Intergenic
1075860717 10:125674458-125674480 ATGGCAACACCTCTCCAGCAAGG - Intronic
1075956565 10:126528411-126528433 CTTGAAAAACAGGTCCAACAGGG + Intronic
1077468443 11:2745305-2745327 ATGGCAACAGAGGTCCAAGAGGG - Intronic
1077587983 11:3469129-3469151 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1077730583 11:4725015-4725037 ATGCAAAAACAGCACCAAGAGGG - Intronic
1079702427 11:23565391-23565413 ATGGCAAATCAGCTCCTCCCTGG + Intergenic
1084243679 11:67840767-67840789 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1084863874 11:72040368-72040390 ATGGCAAAAGAGCTGCAATCAGG + Intronic
1085335046 11:75687169-75687191 ATTGCAAAACCTCTCCATCAAGG - Intergenic
1086744889 11:90412539-90412561 ATGGCAAGACATCTCCTTCAAGG + Intergenic
1089519469 11:119054338-119054360 AAAACTAAACAGCTCCAACAGGG + Intronic
1089758813 11:120707919-120707941 AAGGCAAAACAGCTTCTGCATGG - Intronic
1090247790 11:125229093-125229115 ATGCCAACACCGCTCCCACATGG - Intronic
1092414228 12:8277881-8277903 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1097340761 12:58435490-58435512 GTGGAAAAATAGCTCCAATAGGG + Intergenic
1098344614 12:69488647-69488669 ATGTCAAAACAGCTTCAAATAGG - Intronic
1098764419 12:74468553-74468575 ATTGCAACACATCTCCAGCAAGG - Intergenic
1101680374 12:106958024-106958046 TTGGCAAAAAAGCTAAAACATGG + Intronic
1102077560 12:110072293-110072315 ATGTTACAACAGCTACAACATGG + Intronic
1102246471 12:111359639-111359661 AGAGAAAAACAGCTCCAAGAGGG - Intergenic
1102545899 12:113655236-113655258 CTTACAAAACAGCTCCAAGAGGG + Intergenic
1104898385 12:132175313-132175335 AGGGCACAACACCTCCCACAAGG - Intergenic
1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG + Intronic
1109525199 13:63566349-63566371 ATGTCAAAAAGGGTCCAACACGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110525073 13:76526551-76526573 ATGGCAGAACACCTAAAACACGG + Intergenic
1111056190 13:82953720-82953742 ATAGCAACACCTCTCCAACACGG + Intergenic
1111305770 13:86410469-86410491 ATCGCAAAACCTCTCCAGCAAGG + Intergenic
1112422960 13:99269742-99269764 AGGGGAAAACAGCTTTAACATGG - Intronic
1113045989 13:106155543-106155565 ATGGGAAATCACCTCCAAAATGG + Intergenic
1117058680 14:51938813-51938835 ATGGCAAGGAAGCTCCACCAGGG + Intronic
1117215796 14:53550261-53550283 ATGACAAAACAGCCCCAGAATGG - Intergenic
1117791369 14:59345350-59345372 ATGGCAACACAGCTCACATAAGG + Intronic
1119687409 14:76643703-76643725 CTGGGAAAACAGCTCCAAGCCGG + Intergenic
1120550031 14:85859001-85859023 ATGGCAAAATAGCTGCTCCAAGG - Intergenic
1124112347 15:26803495-26803517 ATAGCAAAACTGCTCAAACTCGG - Intronic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1130030272 15:80307786-80307808 ATTGCAACACCTCTCCAACAAGG - Intergenic
1130610118 15:85353531-85353553 ATGACAAAACAGAATCAACAAGG + Intergenic
1131510507 15:93047325-93047347 ATGGCAAAACAGCTGACACCTGG - Intronic
1133355422 16:5133100-5133122 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1134001728 16:10788125-10788147 AAGGCAAAACAACTCAAACAGGG + Intronic
1138098736 16:54234545-54234567 TTGGGAAAACTGCTGCAACATGG + Intergenic
1142542554 17:671681-671703 ATGGGAAAACTGCTCCAACGAGG - Intronic
1143705515 17:8695293-8695315 CTGGCAAGACAACTCCAAGAGGG - Intergenic
1144410989 17:15001628-15001650 ATGGCTCAACACCTCCCACAAGG - Intergenic
1145051089 17:19661573-19661595 ATGGGAAAACAGCACAAAGAAGG + Intronic
1146817283 17:35953117-35953139 ATCGCAACACCGCTCCAGCAAGG - Intergenic
1149387733 17:56158285-56158307 ATGACAATCCAGTTCCAACATGG + Intronic
1151170001 17:72237796-72237818 ATGGCAAAACAGCCCAAGCTTGG - Intergenic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152382967 17:79951789-79951811 ATGGCAAAACTGCTCCTTCCTGG + Intronic
1155117379 18:22783281-22783303 ATCGCAAGACCTCTCCAACAGGG - Intergenic
1156382232 18:36573558-36573580 ATGGCACCACTGCTCCAACGTGG + Intronic
1156590446 18:38482037-38482059 ATTGCTAAACTGCTCCAAGAAGG - Intergenic
1157934416 18:51857492-51857514 ATGGCAAAACCGCACCAAATTGG - Intergenic
1160014354 18:75129057-75129079 ACGGCAACACACCTCCACCATGG - Intergenic
1162294354 19:9802853-9802875 ATGGCAGGACAGCTCAAACCGGG - Intergenic
926023273 2:9515853-9515875 CTGGCAACACAATTCCAACAAGG - Intronic
928250044 2:29668403-29668425 ATGACAAAACAGTGCTAACAGGG - Intronic
931570521 2:63664475-63664497 TTGGCAAAAGAGCTCCATGAGGG + Intronic
932290499 2:70573532-70573554 ATGGCAATTCAGCTTCAACCTGG + Intergenic
932707545 2:74038356-74038378 ATGGGAACACACCTCCAACTTGG + Intronic
934126573 2:88898743-88898765 GTGGGAAAACAGCACCAGCAAGG + Intergenic
936046933 2:109195583-109195605 ATGCAAAAATAGCTCCAGCAAGG - Intronic
939271837 2:139949148-139949170 ATGGTATAACAAATCCAACAGGG + Intergenic
939324854 2:140674577-140674599 AAGGCAAGACAACTCAAACAGGG - Intronic
943135822 2:183911475-183911497 ATGGGAAAACAACTTTAACATGG + Intergenic
946572389 2:221039215-221039237 GTGGGAAAACAGTTCCAATAAGG + Intergenic
1170121829 20:12920650-12920672 ATGGTAAAACATATCCCACAGGG - Intergenic
1173530741 20:43767383-43767405 CAGGCAAATCACCTCCAACAAGG - Intergenic
1174212027 20:48887394-48887416 ATGGCAAAACCTGGCCAACATGG + Intergenic
1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG + Intronic
1176885162 21:14246387-14246409 ATAGCAGAAAAGCTCCAAAATGG - Intergenic
1178449799 21:32687291-32687313 ATGCCTCCACAGCTCCAACAGGG - Intronic
1180848489 22:18997736-18997758 GTGTCAAAACAACTCCAAGAAGG - Intergenic
1183223932 22:36536447-36536469 ATGGTAAAACAGCTCGATCCTGG - Intergenic
1184587001 22:45454642-45454664 AAGGAAACACAGCTCCAAAAAGG - Intergenic
949978014 3:9478227-9478249 TGGGCAAAACAACTCCACCAAGG - Intronic
950507278 3:13403204-13403226 ATGACAAAACATCACAAACAGGG + Intronic
951295309 3:20926429-20926451 ATGACCAAACACCTCCAACTAGG + Intergenic
952085282 3:29813326-29813348 TTGGCAAAATAGCTCCAAAAAGG + Intronic
953483764 3:43275136-43275158 ATGCCACCCCAGCTCCAACAAGG - Intergenic
953666852 3:44931533-44931555 ATGGCCCAACAGCTCCACCAGGG + Intronic
955733162 3:62008928-62008950 ATGGCACATGGGCTCCAACAGGG - Intronic
956511789 3:70000959-70000981 ATGGCAACACAGCTTCTCCAGGG - Intergenic
957842262 3:85686861-85686883 AAGGCAAGACAACTCCAAAAGGG - Intronic
959805769 3:110551732-110551754 ATAGCAAAACAACAGCAACAAGG - Intergenic
961591235 3:127983347-127983369 ATGGCAAGACACCTCCCACTAGG - Intronic
961745833 3:129062954-129062976 ATGGAAAACAAGCTCCTACAGGG + Intergenic
961824676 3:129592819-129592841 AAGGCAAACCGGCTCAAACACGG + Intronic
961891781 3:130136504-130136526 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
962532601 3:136297546-136297568 CTGGAATATCAGCTCCAACAGGG - Intronic
963220771 3:142809300-142809322 AGGGCAACACTTCTCCAACAGGG - Intergenic
963877830 3:150496591-150496613 ATGGCAACACACCTAAAACAAGG - Intergenic
966071504 3:175884769-175884791 ATTGCAACACATCTCCAGCAAGG - Intergenic
970111799 4:12645871-12645893 ATATCAAAACAGCTATAACAGGG + Intergenic
970207762 4:13672709-13672731 ATGGAAAAGCAGCGCCATCAGGG + Intergenic
971612080 4:28738419-28738441 ATGTCAATATAGCTCCAAAAAGG - Intergenic
971837735 4:31790539-31790561 ATCAGAAAACAGCTCCAAAATGG + Intergenic
972286812 4:37657250-37657272 ATTGGAAAACTGCTCCAGCAAGG - Intronic
972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG + Intronic
974092527 4:57327089-57327111 ATTGCAAAATATCTCCAACATGG + Intergenic
975079248 4:70255528-70255550 ATGTGGAAACAGCTCCAAAATGG + Intergenic
975615471 4:76242206-76242228 ATGACAAAATACCTCCCACAAGG - Intronic
976150570 4:82087182-82087204 ATGGAAAGACAGCAACAACATGG + Intergenic
976747313 4:88416295-88416317 ATAGCAAAACCGCTCTCACAGGG - Intronic
979639075 4:122990877-122990899 AAGGGAAAACAGGTCCAGCATGG - Intronic
980985061 4:139687110-139687132 AAAGCAAAACATCTCTAACAAGG - Intronic
981237663 4:142436866-142436888 ATAGCAACACCTCTCCAACAAGG + Intronic
981527959 4:145725616-145725638 ATACTAAAACAGCTACAACATGG + Intronic
982154569 4:152505722-152505744 ATTGCAAAACAGCCTCAAGAAGG - Intronic
984771836 4:183443712-183443734 AGGAAAAAACAGCTCTAACAGGG + Intergenic
985102151 4:186469179-186469201 AAGGCAGAACAACTCCAAGAGGG - Intronic
986412204 5:7492390-7492412 ATGGCAAAACTGCTGAAACATGG - Intronic
987670747 5:21004215-21004237 ATGGGAAAACAGATCCAAGTAGG + Intergenic
989921419 5:49809271-49809293 ATCGAAAAACAGTTTCAACACGG - Intergenic
989925601 5:49870933-49870955 ATCGAAAAACAGTTTCAACACGG - Intergenic
989927543 5:49899720-49899742 ATCGAAAAACAGTTTCAACACGG - Intergenic
991964384 5:72076745-72076767 CAGGCAAACCAGCTCAAACAGGG - Intergenic
992556361 5:77907208-77907230 CAAGCAAAACATCTCCAACAAGG + Intergenic
993100046 5:83527001-83527023 ATGGCAAAAATGCTCCAAAGAGG - Intronic
993478499 5:88394207-88394229 AAGGCAAAACGACTCCAAGATGG - Intergenic
995588618 5:113674849-113674871 ATGGAAAAACAGCCCCAACTGGG - Intergenic
997609753 5:135207438-135207460 ATGGCAAGAGAGCTCCCAGAGGG - Intronic
998032600 5:138884371-138884393 ATGGCAAATCAGATCCTAAAAGG + Intronic
1000017929 5:157294755-157294777 ATGGTAAAACAGCCTCAGCAGGG - Intronic
1001614172 5:173029095-173029117 ATAGAAAAACAGCTCCCACAGGG - Intronic
1002924398 6:1596436-1596458 ATGGCATCAGAGCTCCATCACGG + Intergenic
1009498039 6:64374521-64374543 CTAGGAAAACATCTCCAACATGG - Intronic
1013828493 6:114244017-114244039 AAGACAGAAAAGCTCCAACAGGG + Intronic
1014948037 6:127519169-127519191 ATCCCAAAACCGCTCGAACACGG + Exonic
1016738301 6:147504342-147504364 ATTGCAAAACAGTTCTAAAATGG + Intergenic
1016776413 6:147909504-147909526 ATGGGAAAAGAGCTCAAACGGGG + Intergenic
1017604791 6:156122458-156122480 ATGGGAAAACAGTTCAAAGAAGG - Intergenic
1018912471 6:168110175-168110197 ATGGCAAAGCAGCTCAAGAAAGG + Intergenic
1023801115 7:43835412-43835434 ATGGTAAAACACGGCCAACATGG + Intergenic
1024653395 7:51428370-51428392 CTGGAAAAGCAGCTTCAACATGG - Intergenic
1025041819 7:55652099-55652121 ATTGCAACACCTCTCCAACAAGG + Intergenic
1027581507 7:80002527-80002549 ATGGTAAAACTGAGCCAACATGG + Intergenic
1031582664 7:123496088-123496110 ATGGAGAAACACCTCCAAGAAGG + Intronic
1031960074 7:127981140-127981162 ATGACAAGAAAGCTCCTACATGG - Intronic
1032787726 7:135213775-135213797 ATGGAAATTCAGCTCCAAAAGGG + Intergenic
1034505580 7:151487145-151487167 ATGGAAAAACTGCTCCAGCGTGG + Intronic
1037367775 8:18141196-18141218 ATGGCAGAACATCTCAAACCAGG - Intergenic
1041482106 8:58332825-58332847 ATTGCAACACATCTCCAGCAAGG + Intergenic
1042047898 8:64674417-64674439 AAGGCAAATCACATCCAACAAGG - Intronic
1043422764 8:80115850-80115872 ATGGCAAAAAATGTTCAACAAGG + Intronic
1044130937 8:88524226-88524248 ATGGCAAAGAAGCCTCAACACGG + Intergenic
1044948151 8:97410237-97410259 ATGGCAAAATTATTCCAACAAGG - Intergenic
1045525268 8:102936075-102936097 ATTGCAAGACAGCTCCTTCACGG - Intronic
1047119219 8:121881632-121881654 ATGCCACAACAGCTCCAATAGGG - Intergenic
1055893323 9:81146258-81146280 CTGGCAAAACAGCTCAATCACGG - Intergenic
1056338069 9:85596831-85596853 ATGGGAAAACACCACCAAAATGG + Intronic
1185874537 X:3691748-3691770 ATGGCAATTCAGCTCCATCAGGG - Intronic
1187617242 X:21010193-21010215 CTGGCAAAACAGATTCACCAAGG + Intergenic
1188507982 X:30904044-30904066 TTGGCCAAACAGTTCCAAAATGG - Intronic
1190989806 X:55535761-55535783 CTGGCAAAAGCGCTCCAGCAAGG + Intergenic
1192944268 X:75949027-75949049 ATCGCAACACATCTCCAGCAAGG - Intergenic
1193348933 X:80434655-80434677 ATGCTAAAACAGCTCCAATTTGG - Intronic
1193687280 X:84592558-84592580 ATTGCAAAACCTCTCCAGCAAGG + Intergenic
1193769456 X:85571841-85571863 CTGGCAAAAATGCTCCAGCAGGG - Intergenic
1194444844 X:93975210-93975232 ATGGCAACATGGCTCCAGCAAGG - Intergenic
1195153541 X:102098175-102098197 ATTGCAACACATCTCCAGCAAGG + Intergenic
1196178314 X:112664453-112664475 ATTGCAAGATAACTCCAACAAGG - Intronic
1199506238 X:148564504-148564526 ATGTCAAAACGCCTCCAAAATGG - Intronic
1199827782 X:151516651-151516673 CTGGCAAAAGTGCTCCAGCAGGG + Intergenic
1200204699 X:154307529-154307551 ATGGCAGAAGTGCTCCCACATGG - Intronic
1201554519 Y:15254686-15254708 ATGGCACACCAGCTCCAGTAAGG + Intergenic