ID: 1124875825

View in Genome Browser
Species Human (GRCh38)
Location 15:33592471-33592493
Sequence CTGGATACAGATATCCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124875825_1124875833 1 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875833 15:33592495-33592517 GGAAGGAAGGTAAGGATGGTGGG 0: 1
1: 1
2: 21
3: 1102
4: 7591
1124875825_1124875838 16 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875838 15:33592510-33592532 ATGGTGGGGCCCACTCCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 161
1124875825_1124875829 -7 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875829 15:33592487-33592509 TATCCAGTGGAAGGAAGGTAAGG 0: 1
1: 0
2: 2
3: 23
4: 200
1124875825_1124875832 0 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875832 15:33592494-33592516 TGGAAGGAAGGTAAGGATGGTGG 0: 1
1: 0
2: 28
3: 579
4: 6427
1124875825_1124875831 -3 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875831 15:33592491-33592513 CAGTGGAAGGAAGGTAAGGATGG 0: 1
1: 1
2: 15
3: 162
4: 1868
1124875825_1124875836 14 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875836 15:33592508-33592530 GGATGGTGGGGCCCACTCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 162
1124875825_1124875835 13 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875835 15:33592507-33592529 AGGATGGTGGGGCCCACTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 208
1124875825_1124875837 15 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875837 15:33592509-33592531 GATGGTGGGGCCCACTCCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 182
1124875825_1124875834 2 Left 1124875825 15:33592471-33592493 CCTTGTTGGATATCTGTATCCAG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1124875834 15:33592496-33592518 GAAGGAAGGTAAGGATGGTGGGG 0: 1
1: 0
2: 5
3: 82
4: 1342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124875825 Original CRISPR CTGGATACAGATATCCAACA AGG (reversed) Intronic
902058428 1:13621427-13621449 CTGAGTACAGATATCCAGCTGGG + Intergenic
908365544 1:63419874-63419896 CTGGTTACAGATTGCCAATAGGG - Intronic
908724645 1:67162539-67162561 CTAGATTCAGAGATCCAAAATGG + Intronic
916324737 1:163544454-163544476 CTGTTTACAGGTATCCAATAAGG - Intergenic
921430094 1:215055707-215055729 CCAGATACAGAAATCCAACCAGG - Intronic
921611549 1:217217980-217218002 TTGGTTATAGACATCCAACATGG - Intergenic
923043449 1:230336809-230336831 ATGGCTACAGATTTCCAACAGGG + Intronic
923505738 1:234605024-234605046 CTGGATAGACTTATCCAAAACGG + Exonic
1064506129 10:16032337-16032359 CTGTATACAGCTATCCCACTGGG - Intergenic
1067870677 10:49957857-49957879 CTGGGCACAGAAATCCAGCAAGG + Intronic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG + Intergenic
1076609593 10:131713894-131713916 CTGCATACTGATTTCCATCATGG + Intergenic
1077278012 11:1726110-1726132 GTGGGTACAGACATCCAAAATGG + Intergenic
1079227484 11:18620031-18620053 CTGAATACTGGTATCCAAAAGGG + Intronic
1081717398 11:45260116-45260138 CTGGATGCAGAGATTCAAGAGGG - Intronic
1087351319 11:97036192-97036214 CTGTATGCAGAAATCCAACATGG - Intergenic
1088791925 11:113233700-113233722 CTGAGTACAGATATCCAAGCAGG - Intronic
1092086344 12:5765801-5765823 TTGCATACATATATCCAATAAGG + Intronic
1098087398 12:66861566-66861588 CTGAATACAGAAATCCCACATGG + Intergenic
1099283979 12:80692116-80692138 CTGGAACAAGATATCCCACAGGG + Intergenic
1100512883 12:95294399-95294421 TTAGAAACAGAAATCCAACAAGG - Intronic
1102234480 12:111285703-111285725 CTGGATCCCGATTTCCCACACGG - Intronic
1104868906 12:131980008-131980030 ATGCATACAGAAAACCAACACGG - Intronic
1105583188 13:21720317-21720339 CCAGATAGAGCTATCCAACAAGG - Intergenic
1106276757 13:28216424-28216446 CTTGACACAGATATACAACCTGG - Intronic
1107010678 13:35667448-35667470 CTGGAGACAGATATCAAGCGTGG - Exonic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1109048748 13:57449533-57449555 CTAGCAACAGATATCCAACATGG + Intergenic
1111469219 13:88655686-88655708 CGGGATACAGAAATCTATCAAGG - Intergenic
1118027807 14:61788217-61788239 CTGAATTCAGATCTCCATCATGG + Intronic
1119577766 14:75743185-75743207 CTTGATATAGATATCCATCATGG + Intronic
1124471177 15:29987370-29987392 CTGGATAAAGCTATACCACAGGG + Intergenic
1124875825 15:33592471-33592493 CTGGATACAGATATCCAACAAGG - Intronic
1126670781 15:51113401-51113423 CTGGATACCGAATTTCAACATGG + Intergenic
1127025730 15:54803883-54803905 GTGGTTTCAGGTATCCAACAGGG - Intergenic
1135130210 16:19847429-19847451 CTGGATCCAGATAGTGAACATGG + Intronic
1135636191 16:24077608-24077630 CTGGATACATTTATCCTAAACGG - Intronic
1137881837 16:52057599-52057621 CGGGAAACAGAGATCCAAAAGGG + Intronic
1138013680 16:53409770-53409792 CAAGGTACAAATATCCAACAAGG - Intergenic
1139655287 16:68383675-68383697 CTGGAAACAGGTAACCCACAAGG - Intronic
1140364728 16:74372434-74372456 TTAGATTCAGATATTCAACATGG - Intergenic
1142184701 16:88689011-88689033 GTGCACACAGGTATCCAACACGG + Intergenic
1143763369 17:9120973-9120995 CTGGAGACAGAAAACCATCAGGG + Intronic
1146688711 17:34858305-34858327 CTTGGTACAGATATCTAGCAAGG - Intergenic
1146773796 17:35593956-35593978 CAGGTTATAGATATCCAACAAGG - Intronic
1148379078 17:47179234-47179256 TTGGAGAAAGACATCCAACAAGG - Intronic
1149946037 17:60928492-60928514 CTGAATACAGATATCTAAACAGG - Intronic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1156317332 18:35982422-35982444 CTGAACACAGTTCTCCAACATGG + Intergenic
1159328390 18:66954158-66954180 ATGGATACAGCAAACCAACATGG + Intergenic
1159347816 18:67229614-67229636 ATAGATACAGAGATCCAAGAAGG - Intergenic
1159393875 18:67830982-67831004 CAGCATACAGATATCCTCCACGG + Intergenic
1165180603 19:33964121-33964143 ATGGATAAAGATGTCCAACAAGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167592133 19:50409733-50409755 CTGGATACAGGTCCCCCACATGG - Intronic
925205039 2:1998303-1998325 CTTGATGCAGATAACCATCATGG + Intronic
926115792 2:10212432-10212454 CTGGATACAAGTATCCTCCATGG + Intergenic
929498763 2:42471405-42471427 ATGAATACAGTTATACAACATGG - Intronic
930697246 2:54424519-54424541 CTTGAGACACATATCCCACAGGG + Intergenic
931578577 2:63747496-63747518 CTGGATAAAGATATCCATATGGG - Intronic
940844841 2:158629292-158629314 CTGGACACAGCTATCCCTCATGG - Intronic
941648227 2:168064973-168064995 CAGGTTACAGAAATCCAACCAGG + Intronic
942549584 2:177100979-177101001 CTGGATAAAGAAATCCCAAAAGG + Intergenic
947392909 2:229657449-229657471 AGGGATACAGATAAGCAACATGG + Intronic
1168960544 20:1866510-1866532 CTGGATACAGGAACTCAACAGGG - Intergenic
1171005261 20:21458573-21458595 CTAGTTACAGATATTCAAAATGG + Intergenic
1172533200 20:35648474-35648496 CTGCCTACAGATATCCAAAATGG - Intronic
1173854577 20:46241791-46241813 CTGGCTACAGCCATCCTACAAGG - Intronic
1178367613 21:32000456-32000478 CTGGATACAGTCAGACAACACGG - Exonic
1178381475 21:32113225-32113247 CTGGATCCTGATACCCAGCATGG + Intergenic
1181896847 22:26117295-26117317 CTGGAGACCGTTATCCTACACGG + Intergenic
1183037321 22:35150100-35150122 CTGGATACAGATATCCCCTTGGG - Intergenic
1183339373 22:37271166-37271188 CAGAATAAAGATATCCATCATGG - Intergenic
952584255 3:34872362-34872384 TTCAATACAGATATTCAACATGG - Intergenic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
957200486 3:77128406-77128428 CTGGTTTCAGATATCCAAGTGGG + Intronic
958043280 3:88251606-88251628 CTGGATACAGCTTTCCAAGAAGG - Intergenic
961153670 3:124661012-124661034 CTAGAGAAAGATATCCAATATGG - Intronic
964467667 3:157015066-157015088 CTGGAAACAGAAGTCAAACAAGG + Intronic
965520296 3:169663269-169663291 CTAGAGACAGATATGCAAGATGG + Intronic
965912828 3:173802483-173802505 ATGAATTCAGATATCCTACAGGG + Intronic
970517053 4:16843156-16843178 CTGGATATAGACATTGAACAAGG - Intronic
972027327 4:34399243-34399265 ATGGCTTCAGATACCCAACAGGG - Intergenic
973203375 4:47531229-47531251 CTGGATACAGACATCTGATAGGG + Intronic
977106998 4:92899370-92899392 CAGGATACAGGCTTCCAACAAGG + Intronic
977593241 4:98849788-98849810 CCTGATACAAAAATCCAACAAGG - Intergenic
978690711 4:111505854-111505876 CTGCATAAATATATACAACATGG + Intergenic
980593468 4:134923096-134923118 ATGGATACAGCAAACCAACATGG - Intergenic
985180913 4:187261257-187261279 CTGGATACATTTACTCAACATGG + Intergenic
985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG + Intergenic
986470653 5:8071009-8071031 CTGTCTATAGACATCCAACATGG - Intergenic
988449550 5:31327137-31327159 CTGGAAATAGATATCCCACTGGG + Exonic
989479806 5:41917406-41917428 CTGCATAAAGATATCCAGCTTGG + Exonic
993815707 5:92542472-92542494 ATGGATGCAGAAAACCAACATGG + Intergenic
996668796 5:126092006-126092028 ATGGGTACAGCTAACCAACATGG + Intergenic
999402304 5:151274583-151274605 CTGAATTCAGATCTTCAACAAGG - Intergenic
999929710 5:156417959-156417981 CTGGATAAAAATATTCAAGATGG + Intronic
999973542 5:156888845-156888867 CTGAATACAGATATCAGACAGGG + Intergenic
1000888145 5:166771491-166771513 CTGAATACAGCTATCAAACCTGG - Intergenic
1000910008 5:167010562-167010584 CTGTATAAAGATATCCTACTTGG + Intergenic
1008428970 6:51392458-51392480 CTCTATACAGATATCTAACCAGG - Intergenic
1011885879 6:92094551-92094573 CTTGATATAGATATACTACAAGG + Intergenic
1012788622 6:103662960-103662982 CTGTTTGCAGATATCAAACATGG - Intergenic
1014153189 6:118082625-118082647 CTGGATCCAGCTATCCCAGAAGG - Intronic
1014519290 6:122420533-122420555 CTGGATTCACATATACAAAATGG - Intronic
1015715771 6:136190883-136190905 CTTGAAAAAGATATCCCACAGGG + Intronic
1016141393 6:140616027-140616049 CTGCAAGCATATATCCAACAAGG - Intergenic
1016797459 6:148133212-148133234 CTAGACACAGATAACCAAGAAGG - Intergenic
1019854599 7:3591959-3591981 CCGGATACAGATGACAAACAAGG + Intronic
1021668457 7:23012375-23012397 CTGGATACAGACACCCGATAAGG - Intronic
1023800143 7:43826846-43826868 CTGCAGACAGACATCCACCATGG - Intergenic
1025014407 7:55427312-55427334 CTGGATACTGATATGGAAGATGG + Intronic
1026213965 7:68331856-68331878 CTGGTTGAAGAAATCCAACAAGG - Intergenic
1027619343 7:80464151-80464173 ATGGATTCAGATATCCTATATGG + Intronic
1032460967 7:132110989-132111011 CTTGAGGCAAATATCCAACAGGG - Intergenic
1034145055 7:148862873-148862895 GTGGGTACAAATGTCCAACATGG + Intronic
1034677187 7:152900413-152900435 CTGGACACAGACACCCAGCAGGG - Intergenic
1036803068 8:11807461-11807483 CTGGAATCATTTATCCAACAGGG - Intronic
1039203647 8:35124706-35124728 CTGGATAACCATAGCCAACATGG + Intergenic
1039327353 8:36500157-36500179 ATAGATACAGATATAGAACAAGG + Intergenic
1041054596 8:53971044-53971066 CTAAAAACAAATATCCAACAGGG + Intronic
1041145500 8:54872099-54872121 ATGGTTTCAGATATCCACCAGGG + Intergenic
1045268014 8:100637055-100637077 CTGGTTACAGAATTCCAATAAGG + Intronic
1047368997 8:124239657-124239679 CTGGGTACAGCAAACCAACATGG - Intergenic
1050162730 9:2734807-2734829 CTGGATGAAGAGAACCAACAAGG - Intronic
1050688545 9:8199360-8199382 CTGGATAGACATATACACCATGG - Intergenic
1051904016 9:22074557-22074579 TTGGATAAAGATTTTCAACAAGG - Intergenic
1053451131 9:38195056-38195078 CTGGAGTCAGATGTCCAAAATGG - Intergenic
1185942723 X:4339295-4339317 ATGGATACAGATATGCATTAGGG + Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1187325566 X:18283712-18283734 CTAGATACAGGTAACCAAGAAGG + Intronic
1187650923 X:21404998-21405020 ATGGATAAATATATCCAAAAAGG - Intronic
1188952395 X:36392394-36392416 CTGTATCCAGACATCCAGCAGGG + Intergenic
1194361350 X:92954367-92954389 CTGGAAAATGATATCCACCAGGG + Intergenic
1195613709 X:106896291-106896313 CCAGATACAGAAAGCCAACAAGG - Intronic
1195951727 X:110282410-110282432 TTGGACACAGATATGCAAGATGG + Intronic
1200669546 Y:6070242-6070264 CTGGAAAATGATATCCACCAGGG + Intergenic