ID: 1124876822

View in Genome Browser
Species Human (GRCh38)
Location 15:33602692-33602714
Sequence AGAACTTGATCAAGTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124876820_1124876822 -6 Left 1124876820 15:33602675-33602697 CCTCTTGCATCACACTAAGAACT 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1124876822 15:33602692-33602714 AGAACTTGATCAAGTGTTGAGGG 0: 1
1: 0
2: 2
3: 18
4: 182
1124876819_1124876822 22 Left 1124876819 15:33602647-33602669 CCTTTATGTTTTGTAATGAAAAT 0: 1
1: 0
2: 2
3: 61
4: 690
Right 1124876822 15:33602692-33602714 AGAACTTGATCAAGTGTTGAGGG 0: 1
1: 0
2: 2
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124876822 Original CRISPR AGAACTTGATCAAGTGTTGA GGG Intronic